Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624772_at:

>probe:Drosophila_2:1624772_at:458:699; Interrogation_Position=3002; Antisense; TTTTACTCACACATATCGTCTTAAG
>probe:Drosophila_2:1624772_at:294:159; Interrogation_Position=3051; Antisense; AAATCGTTGCGGCACTTTTACGGCA
>probe:Drosophila_2:1624772_at:541:339; Interrogation_Position=3062; Antisense; GCACTTTTACGGCAAAGGCTTCCCA
>probe:Drosophila_2:1624772_at:220:571; Interrogation_Position=3078; Antisense; GGCTTCCCAAATTAGATCCTCAGTC
>probe:Drosophila_2:1624772_at:226:631; Interrogation_Position=3094; Antisense; TCCTCAGTCGATTAGGATCGCCTAG
>probe:Drosophila_2:1624772_at:210:477; Interrogation_Position=3143; Antisense; GTTTTGTACAATATTTGCATCCCGC
>probe:Drosophila_2:1624772_at:24:725; Interrogation_Position=3157; Antisense; TTGCATCCCGCAAACGTAGAAGTGT
>probe:Drosophila_2:1624772_at:727:537; Interrogation_Position=3217; Antisense; GGTAATGCCTCTTGGTTACATTCTT
>probe:Drosophila_2:1624772_at:291:541; Interrogation_Position=3230; Antisense; GGTTACATTCTTGATTTTGCAGTTA
>probe:Drosophila_2:1624772_at:401:601; Interrogation_Position=3265; Antisense; TGTTACACCTTCTTTCCTTTAGATG
>probe:Drosophila_2:1624772_at:646:641; Interrogation_Position=3277; Antisense; TTTCCTTTAGATGCGTTTACGTGGC
>probe:Drosophila_2:1624772_at:70:703; Interrogation_Position=3293; Antisense; TTACGTGGCAGTTTAAGCTTCTACC
>probe:Drosophila_2:1624772_at:462:343; Interrogation_Position=3309; Antisense; GCTTCTACCTGAGCTGTATATAAAC
>probe:Drosophila_2:1624772_at:55:199; Interrogation_Position=3418; Antisense; AACGAATCGATCAAAGCGGATGACA

Paste this into a BLAST search page for me
TTTTACTCACACATATCGTCTTAAGAAATCGTTGCGGCACTTTTACGGCAGCACTTTTACGGCAAAGGCTTCCCAGGCTTCCCAAATTAGATCCTCAGTCTCCTCAGTCGATTAGGATCGCCTAGGTTTTGTACAATATTTGCATCCCGCTTGCATCCCGCAAACGTAGAAGTGTGGTAATGCCTCTTGGTTACATTCTTGGTTACATTCTTGATTTTGCAGTTATGTTACACCTTCTTTCCTTTAGATGTTTCCTTTAGATGCGTTTACGTGGCTTACGTGGCAGTTTAAGCTTCTACCGCTTCTACCTGAGCTGTATATAAACAACGAATCGATCAAAGCGGATGACA

Full Affymetrix probeset data:

Annotations for 1624772_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime