FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624775_at:

>probe:Drosophila_2:1624775_at:298:593; Interrogation_Position=1008; Antisense; TGCGTCCGAAACAGGTGCTCAATTT
>probe:Drosophila_2:1624775_at:413:653; Interrogation_Position=1026; Antisense; TCAATTTCGACAGCATTGTCCCCAT
>probe:Drosophila_2:1624775_at:445:23; Interrogation_Position=1049; Antisense; ATATCGGCCATGAACTCGTCGAAGA
>probe:Drosophila_2:1624775_at:626:393; Interrogation_Position=1084; Antisense; GAAATCCCAGCTAAGGAGGACCCTG
>probe:Drosophila_2:1624775_at:407:65; Interrogation_Position=725; Antisense; ATGGGTCACAAGTTCCTGAAGCACA
>probe:Drosophila_2:1624775_at:522:457; Interrogation_Position=782; Antisense; GATATATTCGGCTTCCAGCTGAGTC
>probe:Drosophila_2:1624775_at:216:45; Interrogation_Position=819; Antisense; ATCGCGACTGCTTGGCCAATGTGTA
>probe:Drosophila_2:1624775_at:320:309; Interrogation_Position=833; Antisense; GCCAATGTGTATGCGCTCAACAAAG
>probe:Drosophila_2:1624775_at:336:117; Interrogation_Position=864; Antisense; AGCTCTACGATCCATCGCTGCTGGA
>probe:Drosophila_2:1624775_at:21:309; Interrogation_Position=894; Antisense; CCAGTGTCCTGCTGCTGAACAAAAT
>probe:Drosophila_2:1624775_at:681:505; Interrogation_Position=930; Antisense; GTGCCCACGAGATCTTTACCAAAGT
>probe:Drosophila_2:1624775_at:324:697; Interrogation_Position=944; Antisense; TTTACCAAAGTTAAGCCGCTCGTCA
>probe:Drosophila_2:1624775_at:226:263; Interrogation_Position=967; Antisense; CAGCGATTTGGCCAGCGGACTTGAA
>probe:Drosophila_2:1624775_at:311:557; Interrogation_Position=983; Antisense; GGACTTGAACAGTGCCCCGAGGAAC

Paste this into a BLAST search page for me
TGCGTCCGAAACAGGTGCTCAATTTTCAATTTCGACAGCATTGTCCCCATATATCGGCCATGAACTCGTCGAAGAGAAATCCCAGCTAAGGAGGACCCTGATGGGTCACAAGTTCCTGAAGCACAGATATATTCGGCTTCCAGCTGAGTCATCGCGACTGCTTGGCCAATGTGTAGCCAATGTGTATGCGCTCAACAAAGAGCTCTACGATCCATCGCTGCTGGACCAGTGTCCTGCTGCTGAACAAAATGTGCCCACGAGATCTTTACCAAAGTTTTACCAAAGTTAAGCCGCTCGTCACAGCGATTTGGCCAGCGGACTTGAAGGACTTGAACAGTGCCCCGAGGAAC

Full Affymetrix probeset data:

Annotations for 1624775_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720