Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624776_a_at:

>probe:Drosophila_2:1624776_a_at:711:237; Interrogation_Position=350; Antisense; AATCACAGGCCTCCAGGATGATGCA
>probe:Drosophila_2:1624776_a_at:186:59; Interrogation_Position=367; Antisense; ATGATGCACAGGATCGCCGTGCCAT
>probe:Drosophila_2:1624776_a_at:73:507; Interrogation_Position=385; Antisense; GTGCCATCGATGACCAGCCAGTTGA
>probe:Drosophila_2:1624776_a_at:117:119; Interrogation_Position=542; Antisense; AGCTCAACGTTGAGTCGCACTTCAT
>probe:Drosophila_2:1624776_a_at:70:277; Interrogation_Position=561; Antisense; CTTCATCAACGACTTGGGACTGGAT
>probe:Drosophila_2:1624776_a_at:256:407; Interrogation_Position=578; Antisense; GACTGGATTCCTTGGACCACGTGGA
>probe:Drosophila_2:1624776_a_at:163:129; Interrogation_Position=593; Antisense; ACCACGTGGAGGTCATCATGGCCAT
>probe:Drosophila_2:1624776_a_at:313:405; Interrogation_Position=622; Antisense; GACGAGTTCGGTTTCGAGATCCCCG
>probe:Drosophila_2:1624776_a_at:262:449; Interrogation_Position=639; Antisense; GATCCCCGACTCTGATGCCGAGAAG
>probe:Drosophila_2:1624776_a_at:350:423; Interrogation_Position=658; Antisense; GAGAAGCTGCTTAAACCTGCCGACA
>probe:Drosophila_2:1624776_a_at:32:401; Interrogation_Position=679; Antisense; GACATTATTAAGTACGTCGCCGACA
>probe:Drosophila_2:1624776_a_at:134:617; Interrogation_Position=737; Antisense; TGCAAGCCATTGAACGGATTACACT
>probe:Drosophila_2:1624776_a_at:475:495; Interrogation_Position=833; Antisense; GTCAGCAATTGTACACGAGGGCTAT
>probe:Drosophila_2:1624776_a_at:676:293; Interrogation_Position=848; Antisense; CGAGGGCTATAATTAACTGCGGAAT

Paste this into a BLAST search page for me
AATCACAGGCCTCCAGGATGATGCAATGATGCACAGGATCGCCGTGCCATGTGCCATCGATGACCAGCCAGTTGAAGCTCAACGTTGAGTCGCACTTCATCTTCATCAACGACTTGGGACTGGATGACTGGATTCCTTGGACCACGTGGAACCACGTGGAGGTCATCATGGCCATGACGAGTTCGGTTTCGAGATCCCCGGATCCCCGACTCTGATGCCGAGAAGGAGAAGCTGCTTAAACCTGCCGACAGACATTATTAAGTACGTCGCCGACATGCAAGCCATTGAACGGATTACACTGTCAGCAATTGTACACGAGGGCTATCGAGGGCTATAATTAACTGCGGAAT

Full Affymetrix probeset data:

Annotations for 1624776_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime