FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624777_at:

>probe:Drosophila_2:1624777_at:620:219; Interrogation_Position=109; Antisense; AAGTCCTGGCTCGACCAGAACGTAA
>probe:Drosophila_2:1624777_at:6:221; Interrogation_Position=134; Antisense; AAGGGCGTCAGGACTCGGACACGAT
>probe:Drosophila_2:1624777_at:438:281; Interrogation_Position=147; Antisense; CTCGGACACGATTGACACACTTATA
>probe:Drosophila_2:1624777_at:109:159; Interrogation_Position=163; Antisense; ACACTTATAATGCTGTGCGTCATAG
>probe:Drosophila_2:1624777_at:518:343; Interrogation_Position=207; Antisense; GCTTCCAGCTAAAATTGCCAACTTT
>probe:Drosophila_2:1624777_at:187:629; Interrogation_Position=222; Antisense; TGCCAACTTTCGGATAACCAACAAG
>probe:Drosophila_2:1624777_at:37:183; Interrogation_Position=257; Antisense; AAAACTACATAATCCTGCCGACCAT
>probe:Drosophila_2:1624777_at:586:233; Interrogation_Position=267; Antisense; AATCCTGCCGACCATTAAAATTCCA
>probe:Drosophila_2:1624777_at:445:179; Interrogation_Position=291; Antisense; AAACATTACCATCATCTTTGCAGAT
>probe:Drosophila_2:1624777_at:397:217; Interrogation_Position=319; Antisense; AAGTTACCTGTATCAGCGCGATCGA
>probe:Drosophila_2:1624777_at:342:103; Interrogation_Position=34; Antisense; AGACTCGATTCTTTAGCCATTCTCT
>probe:Drosophila_2:1624777_at:681:459; Interrogation_Position=383; Antisense; GATTTCTTAAAGACTGCATAACCAA
>probe:Drosophila_2:1624777_at:341:29; Interrogation_Position=412; Antisense; ATAAACCTACTGGATTTCTTAGAGG
>probe:Drosophila_2:1624777_at:374:707; Interrogation_Position=46; Antisense; TTAGCCATTCTCTACCTGTTTCAAT

Paste this into a BLAST search page for me
AAGTCCTGGCTCGACCAGAACGTAAAAGGGCGTCAGGACTCGGACACGATCTCGGACACGATTGACACACTTATAACACTTATAATGCTGTGCGTCATAGGCTTCCAGCTAAAATTGCCAACTTTTGCCAACTTTCGGATAACCAACAAGAAAACTACATAATCCTGCCGACCATAATCCTGCCGACCATTAAAATTCCAAAACATTACCATCATCTTTGCAGATAAGTTACCTGTATCAGCGCGATCGAAGACTCGATTCTTTAGCCATTCTCTGATTTCTTAAAGACTGCATAACCAAATAAACCTACTGGATTTCTTAGAGGTTAGCCATTCTCTACCTGTTTCAAT

Full Affymetrix probeset data:

Annotations for 1624777_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720