Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624778_at:

>probe:Drosophila_2:1624778_at:414:93; Interrogation_Position=4753; Antisense; AGTTCTAGTCTTCCGGTACAATCAG
>probe:Drosophila_2:1624778_at:709:465; Interrogation_Position=4791; Antisense; GATTGGACTGATGCAAACGCTTGAA
>probe:Drosophila_2:1624778_at:448:161; Interrogation_Position=4814; Antisense; AAATTAAGCCGGCTGCGTCGCAGTC
>probe:Drosophila_2:1624778_at:672:377; Interrogation_Position=4914; Antisense; GAAGCATCGAGTGCCTCGCATCGGA
>probe:Drosophila_2:1624778_at:348:635; Interrogation_Position=4929; Antisense; TCGCATCGGAGCCAAGTTCGACTTG
>probe:Drosophila_2:1624778_at:234:403; Interrogation_Position=4948; Antisense; GACTTGGAATACATACTGCCCGACT
>probe:Drosophila_2:1624778_at:157:539; Interrogation_Position=5013; Antisense; GGTTCAAATCCCACCTAGCTGAAGA
>probe:Drosophila_2:1624778_at:275:395; Interrogation_Position=5036; Antisense; GAAATGCAACGCTATTTGGATCTTA
>probe:Drosophila_2:1624778_at:435:687; Interrogation_Position=5059; Antisense; TATATCACCTTATTTCTATCTCTCC
>probe:Drosophila_2:1624778_at:678:685; Interrogation_Position=5075; Antisense; TATCTCTCCTAGTCTGTGCGAGGCA
>probe:Drosophila_2:1624778_at:615:109; Interrogation_Position=5102; Antisense; AGAATTGCCGCACACGATAGATCAT
>probe:Drosophila_2:1624778_at:386:403; Interrogation_Position=5167; Antisense; GACTGACTCGTCTTTATATTTTTTC
>probe:Drosophila_2:1624778_at:626:663; Interrogation_Position=5303; Antisense; TAAAGCTGTCAGTGCCACGCAATCT
>probe:Drosophila_2:1624778_at:155:259; Interrogation_Position=5318; Antisense; CACGCAATCTGTGGCTAATTTCAAA

Paste this into a BLAST search page for me
AGTTCTAGTCTTCCGGTACAATCAGGATTGGACTGATGCAAACGCTTGAAAAATTAAGCCGGCTGCGTCGCAGTCGAAGCATCGAGTGCCTCGCATCGGATCGCATCGGAGCCAAGTTCGACTTGGACTTGGAATACATACTGCCCGACTGGTTCAAATCCCACCTAGCTGAAGAGAAATGCAACGCTATTTGGATCTTATATATCACCTTATTTCTATCTCTCCTATCTCTCCTAGTCTGTGCGAGGCAAGAATTGCCGCACACGATAGATCATGACTGACTCGTCTTTATATTTTTTCTAAAGCTGTCAGTGCCACGCAATCTCACGCAATCTGTGGCTAATTTCAAA

Full Affymetrix probeset data:

Annotations for 1624778_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime