FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624779_at:

>probe:Drosophila_2:1624779_at:612:165; Interrogation_Position=1048; Antisense; AAATCGGCGCTGACCAAGAAGATCA
>probe:Drosophila_2:1624779_at:477:389; Interrogation_Position=1077; Antisense; GAAACAACTGCAGGCCGTGAAAGAT
>probe:Drosophila_2:1624779_at:367:137; Interrogation_Position=1200; Antisense; ACGTTTACAAACTGTGCATCCTAAG
>probe:Drosophila_2:1624779_at:722:277; Interrogation_Position=675; Antisense; CTACCTGGACAAACGCATCTGGTTC
>probe:Drosophila_2:1624779_at:83:397; Interrogation_Position=701; Antisense; GAAATTTCCAGATTCTATCCGAAGA
>probe:Drosophila_2:1624779_at:280:297; Interrogation_Position=720; Antisense; CGAAGATGGCGGTTTGTCCGAAGTC
>probe:Drosophila_2:1624779_at:375:577; Interrogation_Position=746; Antisense; GGCCGCGTTACGTGATGAATCCTGT
>probe:Drosophila_2:1624779_at:8:691; Interrogation_Position=776; Antisense; TATTCGATGGTTCCTTCACTGGCAA
>probe:Drosophila_2:1624779_at:695:419; Interrogation_Position=811; Antisense; GAGAATCCGGACTACGTGAGTCCAT
>probe:Drosophila_2:1624779_at:199:513; Interrogation_Position=826; Antisense; GTGAGTCCATCCAAACAGCGGCAGG
>probe:Drosophila_2:1624779_at:163:171; Interrogation_Position=897; Antisense; AAAGGTCAAGCACGAGGCCACGCGA
>probe:Drosophila_2:1624779_at:409:259; Interrogation_Position=915; Antisense; CACGCGACCTATTAGAGCCTACGAT
>probe:Drosophila_2:1624779_at:227:117; Interrogation_Position=956; Antisense; AGCTATTCGAGGACGATGATCCCGT
>probe:Drosophila_2:1624779_at:384:407; Interrogation_Position=984; Antisense; GACGGCCAAGATACTGGCTGCGATA

Paste this into a BLAST search page for me
AAATCGGCGCTGACCAAGAAGATCAGAAACAACTGCAGGCCGTGAAAGATACGTTTACAAACTGTGCATCCTAAGCTACCTGGACAAACGCATCTGGTTCGAAATTTCCAGATTCTATCCGAAGACGAAGATGGCGGTTTGTCCGAAGTCGGCCGCGTTACGTGATGAATCCTGTTATTCGATGGTTCCTTCACTGGCAAGAGAATCCGGACTACGTGAGTCCATGTGAGTCCATCCAAACAGCGGCAGGAAAGGTCAAGCACGAGGCCACGCGACACGCGACCTATTAGAGCCTACGATAGCTATTCGAGGACGATGATCCCGTGACGGCCAAGATACTGGCTGCGATA

Full Affymetrix probeset data:

Annotations for 1624779_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720