Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624780_at:

>probe:Drosophila_2:1624780_at:598:341; Interrogation_Position=5944; Antisense; GCTTTCTTTCTTTTTTGACTGCCAA
>probe:Drosophila_2:1624780_at:659:403; Interrogation_Position=5960; Antisense; GACTGCCAAATGTTTCGTGGTTAAC
>probe:Drosophila_2:1624780_at:580:653; Interrogation_Position=6072; Antisense; TAATGTTTTTATTCTTAGTACCTGT
>probe:Drosophila_2:1624780_at:398:15; Interrogation_Position=6105; Antisense; ATTAGTTTATACTTTCTGCGCGAAA
>probe:Drosophila_2:1624780_at:663:691; Interrogation_Position=6117; Antisense; TTTCTGCGCGAAACAAACTAATGAC
>probe:Drosophila_2:1624780_at:347:525; Interrogation_Position=6149; Antisense; GGGCATATCAAAATTGTTTCCCGAT
>probe:Drosophila_2:1624780_at:61:305; Interrogation_Position=6169; Antisense; CCGATATTGTGGGTGTGCGTGTTTC
>probe:Drosophila_2:1624780_at:398:329; Interrogation_Position=6184; Antisense; TGCGTGTTTCCGGAACGTAAATGTT
>probe:Drosophila_2:1624780_at:145:707; Interrogation_Position=6221; Antisense; TTAGACTTGGACATTACCAGGCATA
>probe:Drosophila_2:1624780_at:78:547; Interrogation_Position=6261; Antisense; GGAGGAAAGACCATCTAGTCATAAG
>probe:Drosophila_2:1624780_at:579:697; Interrogation_Position=6359; Antisense; TTTAATTTGTATGAGCTCTGGAGCA
>probe:Drosophila_2:1624780_at:183:675; Interrogation_Position=6447; Antisense; TAGACCGTTTAAATTGACCTGTAAT
>probe:Drosophila_2:1624780_at:345:247; Interrogation_Position=6458; Antisense; AATTGACCTGTAATGGGCAACTAAA
>probe:Drosophila_2:1624780_at:707:563; Interrogation_Position=6473; Antisense; GGCAACTAAATGTTACTCGCAACCA

Paste this into a BLAST search page for me
GCTTTCTTTCTTTTTTGACTGCCAAGACTGCCAAATGTTTCGTGGTTAACTAATGTTTTTATTCTTAGTACCTGTATTAGTTTATACTTTCTGCGCGAAATTTCTGCGCGAAACAAACTAATGACGGGCATATCAAAATTGTTTCCCGATCCGATATTGTGGGTGTGCGTGTTTCTGCGTGTTTCCGGAACGTAAATGTTTTAGACTTGGACATTACCAGGCATAGGAGGAAAGACCATCTAGTCATAAGTTTAATTTGTATGAGCTCTGGAGCATAGACCGTTTAAATTGACCTGTAATAATTGACCTGTAATGGGCAACTAAAGGCAACTAAATGTTACTCGCAACCA

Full Affymetrix probeset data:

Annotations for 1624780_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime