Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624782_a_at:

>probe:Drosophila_2:1624782_a_at:185:35; Interrogation_Position=1105; Antisense; ATCACAGCGTGAGATCCGAGCGTAA
>probe:Drosophila_2:1624782_a_at:686:447; Interrogation_Position=1117; Antisense; GATCCGAGCGTAATTATTGTTTTTT
>probe:Drosophila_2:1624782_a_at:549:185; Interrogation_Position=1218; Antisense; AACACAATTTTTGTAGACGGCGCCA
>probe:Drosophila_2:1624782_a_at:297:251; Interrogation_Position=648; Antisense; CAAGGTGGCCACACGTGCGTGGAAT
>probe:Drosophila_2:1624782_a_at:82:661; Interrogation_Position=673; Antisense; TAAAAAGAGATTGTGTGGCGGCTGC
>probe:Drosophila_2:1624782_a_at:423:639; Interrogation_Position=713; Antisense; TCGGTGGCAGCGTATGCTTATTAAT
>probe:Drosophila_2:1624782_a_at:392:97; Interrogation_Position=749; Antisense; AGATCGAGTGCGGTTATTGTGGCAA
>probe:Drosophila_2:1624782_a_at:396:231; Interrogation_Position=828; Antisense; AATGCGATAGGAGCGTCACTATGAA
>probe:Drosophila_2:1624782_a_at:415:147; Interrogation_Position=845; Antisense; ACTATGAAGAGGTCGTCGTCGTCCC
>probe:Drosophila_2:1624782_a_at:95:503; Interrogation_Position=865; Antisense; GTCCCTTCCGTCATGAACTATGTCA
>probe:Drosophila_2:1624782_a_at:671:59; Interrogation_Position=884; Antisense; ATGTCATCGTGTTTGGTTACCTTAC
>probe:Drosophila_2:1624782_a_at:425:589; Interrogation_Position=897; Antisense; TGGTTACCTTACTCTTCTTACTACT
>probe:Drosophila_2:1624782_a_at:433:669; Interrogation_Position=906; Antisense; TACTCTTCTTACTACTTCAACTTCA
>probe:Drosophila_2:1624782_a_at:44:669; Interrogation_Position=918; Antisense; TACTTCAACTTCAGTCCCCAAACAA

Paste this into a BLAST search page for me
ATCACAGCGTGAGATCCGAGCGTAAGATCCGAGCGTAATTATTGTTTTTTAACACAATTTTTGTAGACGGCGCCACAAGGTGGCCACACGTGCGTGGAATTAAAAAGAGATTGTGTGGCGGCTGCTCGGTGGCAGCGTATGCTTATTAATAGATCGAGTGCGGTTATTGTGGCAAAATGCGATAGGAGCGTCACTATGAAACTATGAAGAGGTCGTCGTCGTCCCGTCCCTTCCGTCATGAACTATGTCAATGTCATCGTGTTTGGTTACCTTACTGGTTACCTTACTCTTCTTACTACTTACTCTTCTTACTACTTCAACTTCATACTTCAACTTCAGTCCCCAAACAA

Full Affymetrix probeset data:

Annotations for 1624782_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime