FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624783_at:

>probe:Drosophila_2:1624783_at:380:29; Interrogation_Position=2160; Antisense; ATACAGTACGGAGAGCCAGTCCTCG
>probe:Drosophila_2:1624783_at:84:469; Interrogation_Position=2191; Antisense; GTTGAGGCACCCAAACCAGAGGAGC
>probe:Drosophila_2:1624783_at:582:147; Interrogation_Position=2305; Antisense; ACTATTGCTCCGGACTGCGACAGGG
>probe:Drosophila_2:1624783_at:640:349; Interrogation_Position=2355; Antisense; GCAGAAGTCCCAGCGCCTGGTGGAA
>probe:Drosophila_2:1624783_at:257:519; Interrogation_Position=2374; Antisense; GTGGAAGCACCCAGTTCCGAGGTAT
>probe:Drosophila_2:1624783_at:454:125; Interrogation_Position=2435; Antisense; AGCCGGATGTGGACGTCTCGCTTAA
>probe:Drosophila_2:1624783_at:59:657; Interrogation_Position=2457; Antisense; TAATGGAGCCGCTGGCCATCTGAAA
>probe:Drosophila_2:1624783_at:621:137; Interrogation_Position=2486; Antisense; ACGAGAGGGTCATCGCAGCAACAGC
>probe:Drosophila_2:1624783_at:404:43; Interrogation_Position=2560; Antisense; ATCGTTGTCAATCATCCATTCCAGA
>probe:Drosophila_2:1624783_at:508:47; Interrogation_Position=2573; Antisense; ATCCATTCCAGACGGTACGCGAAGT
>probe:Drosophila_2:1624783_at:40:369; Interrogation_Position=2593; Antisense; GAAGTGGTCGAGCACGAGCCCTTCA
>probe:Drosophila_2:1624783_at:386:95; Interrogation_Position=2630; Antisense; AGATTCAGGTGAACGAGCCGGCTCC
>probe:Drosophila_2:1624783_at:395:257; Interrogation_Position=2701; Antisense; CACGGGAGTTTGGTCCATTTCCAGA
>probe:Drosophila_2:1624783_at:69:299; Interrogation_Position=2733; Antisense; CGCCCATGGCAATCTATACGGATAA

Paste this into a BLAST search page for me
ATACAGTACGGAGAGCCAGTCCTCGGTTGAGGCACCCAAACCAGAGGAGCACTATTGCTCCGGACTGCGACAGGGGCAGAAGTCCCAGCGCCTGGTGGAAGTGGAAGCACCCAGTTCCGAGGTATAGCCGGATGTGGACGTCTCGCTTAATAATGGAGCCGCTGGCCATCTGAAAACGAGAGGGTCATCGCAGCAACAGCATCGTTGTCAATCATCCATTCCAGAATCCATTCCAGACGGTACGCGAAGTGAAGTGGTCGAGCACGAGCCCTTCAAGATTCAGGTGAACGAGCCGGCTCCCACGGGAGTTTGGTCCATTTCCAGACGCCCATGGCAATCTATACGGATAA

Full Affymetrix probeset data:

Annotations for 1624783_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720