FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624788_at:

>probe:Drosophila_2:1624788_at:623:211; Interrogation_Position=1006; Antisense; AAGACACTTTTCTCATCGAGGGCAG
>probe:Drosophila_2:1624788_at:103:511; Interrogation_Position=1056; Antisense; GTGCAAGATCCTACTGTTCAAGACA
>probe:Drosophila_2:1624788_at:344:653; Interrogation_Position=1073; Antisense; TCAAGACAGAGGATCGTCCGCCAGT
>probe:Drosophila_2:1624788_at:471:313; Interrogation_Position=1092; Antisense; GCCAGTGGCATTCATTACACGGTGT
>probe:Drosophila_2:1624788_at:136:51; Interrogation_Position=1110; Antisense; ACGGTGTTCGAGTAACCTATGGGCA
>probe:Drosophila_2:1624788_at:554:489; Interrogation_Position=1181; Antisense; GTACTATTTATTCGCGTAGGCAACA
>probe:Drosophila_2:1624788_at:370:217; Interrogation_Position=696; Antisense; AAGTTTATGCCATTCCGAACCACCA
>probe:Drosophila_2:1624788_at:727:647; Interrogation_Position=802; Antisense; TCATCCAGCACAAAGAGGCCCAGTT
>probe:Drosophila_2:1624788_at:468:65; Interrogation_Position=817; Antisense; AGGCCCAGTTGGTGCCATTGGCTGA
>probe:Drosophila_2:1624788_at:555:273; Interrogation_Position=832; Antisense; CATTGGCTGAGTCGGCTGCGTTACA
>probe:Drosophila_2:1624788_at:406:75; Interrogation_Position=880; Antisense; AGGAGGTTCGCATTCAGCAGGCTGA
>probe:Drosophila_2:1624788_at:538:613; Interrogation_Position=902; Antisense; TGAACAGCGGCTGGCCAGGCTTAAA
>probe:Drosophila_2:1624788_at:267:709; Interrogation_Position=922; Antisense; TTAAAGACTCTCGACTCCGACTTGG
>probe:Drosophila_2:1624788_at:244:579; Interrogation_Position=945; Antisense; GGCCTGCCCGAGGAATCGATTGTGA

Paste this into a BLAST search page for me
AAGACACTTTTCTCATCGAGGGCAGGTGCAAGATCCTACTGTTCAAGACATCAAGACAGAGGATCGTCCGCCAGTGCCAGTGGCATTCATTACACGGTGTACGGTGTTCGAGTAACCTATGGGCAGTACTATTTATTCGCGTAGGCAACAAAGTTTATGCCATTCCGAACCACCATCATCCAGCACAAAGAGGCCCAGTTAGGCCCAGTTGGTGCCATTGGCTGACATTGGCTGAGTCGGCTGCGTTACAAGGAGGTTCGCATTCAGCAGGCTGATGAACAGCGGCTGGCCAGGCTTAAATTAAAGACTCTCGACTCCGACTTGGGGCCTGCCCGAGGAATCGATTGTGA

Full Affymetrix probeset data:

Annotations for 1624788_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720