FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624790_at:

>probe:Drosophila_2:1624790_at:186:531; Interrogation_Position=4925; Antisense; GGGTCAATCTCCTCGAGAGTGGCAC
>probe:Drosophila_2:1624790_at:661:99; Interrogation_Position=4940; Antisense; AGAGTGGCACCCAGAGCAGCGTGAC
>probe:Drosophila_2:1624790_at:376:263; Interrogation_Position=4951; Antisense; CAGAGCAGCGTGACCATGAGCAGCA
>probe:Drosophila_2:1624790_at:422:147; Interrogation_Position=5009; Antisense; ACTACGAGTCCAACTTGAGCCTGAA
>probe:Drosophila_2:1624790_at:447:249; Interrogation_Position=5019; Antisense; CAACTTGAGCCTGAACGACGACGAA
>probe:Drosophila_2:1624790_at:367:35; Interrogation_Position=5057; Antisense; ATCAGCAGAAGAACCTGTGGGCGTA
>probe:Drosophila_2:1624790_at:32:281; Interrogation_Position=5145; Antisense; CTGCGCAACCAGTGAATTTATAAAG
>probe:Drosophila_2:1624790_at:391:521; Interrogation_Position=5226; Antisense; GTGGCAGGCAGTTAGCATACTTTTT
>probe:Drosophila_2:1624790_at:225:667; Interrogation_Position=5243; Antisense; TACTTTTTGGGATGGTTCACACAGA
>probe:Drosophila_2:1624790_at:511:529; Interrogation_Position=5251; Antisense; GGGATGGTTCACACAGACTGATACT
>probe:Drosophila_2:1624790_at:610:263; Interrogation_Position=5264; Antisense; CAGACTGATACTTTTAGTTCTTTAA
>probe:Drosophila_2:1624790_at:33:689; Interrogation_Position=5302; Antisense; TATTACCCTGTAAATAGAGCCAGAG
>probe:Drosophila_2:1624790_at:170:413; Interrogation_Position=5339; Antisense; TACTATACCTTAAAATGGGATTTCA
>probe:Drosophila_2:1624790_at:228:493; Interrogation_Position=5407; Antisense; GTAAGGGCCTGTACATATTTATATA

Paste this into a BLAST search page for me
GGGTCAATCTCCTCGAGAGTGGCACAGAGTGGCACCCAGAGCAGCGTGACCAGAGCAGCGTGACCATGAGCAGCAACTACGAGTCCAACTTGAGCCTGAACAACTTGAGCCTGAACGACGACGAAATCAGCAGAAGAACCTGTGGGCGTACTGCGCAACCAGTGAATTTATAAAGGTGGCAGGCAGTTAGCATACTTTTTTACTTTTTGGGATGGTTCACACAGAGGGATGGTTCACACAGACTGATACTCAGACTGATACTTTTAGTTCTTTAATATTACCCTGTAAATAGAGCCAGAGTACTATACCTTAAAATGGGATTTCAGTAAGGGCCTGTACATATTTATATA

Full Affymetrix probeset data:

Annotations for 1624790_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720