FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624792_at:

>probe:Drosophila_2:1624792_at:327:175; Interrogation_Position=110; Antisense; AAACCAGTTGTGTGGGCACGCGTCA
>probe:Drosophila_2:1624792_at:20:487; Interrogation_Position=171; Antisense; GTACCCAGGTGAAGGTCGAGTTCCT
>probe:Drosophila_2:1624792_at:367:189; Interrogation_Position=20; Antisense; AACTTCCTTTTTGCTTGCGGCTGTC
>probe:Drosophila_2:1624792_at:232:381; Interrogation_Position=205; Antisense; GAACCGCCAGATTATCCGAAACGTG
>probe:Drosophila_2:1624792_at:470:261; Interrogation_Position=253; Antisense; CATCCTGACCCTTTTGGAATCCGAA
>probe:Drosophila_2:1624792_at:171:439; Interrogation_Position=289; Antisense; GAGGCTGCGCTAATTGGCGACCAAA
>probe:Drosophila_2:1624792_at:644:421; Interrogation_Position=317; Antisense; GAGAAGACCTTTTTACACACACATA
>probe:Drosophila_2:1624792_at:410:159; Interrogation_Position=343; Antisense; ACAAAACTGTTTTTCGCACGCGCCT
>probe:Drosophila_2:1624792_at:24:107; Interrogation_Position=402; Antisense; AGAAATCCGAACGAGGCTGCTGCAT
>probe:Drosophila_2:1624792_at:168:439; Interrogation_Position=414; Antisense; GAGGCTGCTGCATATTCGTTATAAA
>probe:Drosophila_2:1624792_at:510:163; Interrogation_Position=446; Antisense; AAATACACACCTAATTCGCCAGAAA
>probe:Drosophila_2:1624792_at:229:165; Interrogation_Position=494; Antisense; AAATCTCGAGAGCATTGGACCGCCT
>probe:Drosophila_2:1624792_at:38:345; Interrogation_Position=505; Antisense; GCATTGGACCGCCTTTGTACGAAAA
>probe:Drosophila_2:1624792_at:677:123; Interrogation_Position=51; Antisense; AGCGCATCTTGCACGTGAATTCTCT

Paste this into a BLAST search page for me
AAACCAGTTGTGTGGGCACGCGTCAGTACCCAGGTGAAGGTCGAGTTCCTAACTTCCTTTTTGCTTGCGGCTGTCGAACCGCCAGATTATCCGAAACGTGCATCCTGACCCTTTTGGAATCCGAAGAGGCTGCGCTAATTGGCGACCAAAGAGAAGACCTTTTTACACACACATAACAAAACTGTTTTTCGCACGCGCCTAGAAATCCGAACGAGGCTGCTGCATGAGGCTGCTGCATATTCGTTATAAAAAATACACACCTAATTCGCCAGAAAAAATCTCGAGAGCATTGGACCGCCTGCATTGGACCGCCTTTGTACGAAAAAGCGCATCTTGCACGTGAATTCTCT

Full Affymetrix probeset data:

Annotations for 1624792_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720