FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624793_at:

>probe:Drosophila_2:1624793_at:31:609; Interrogation_Position=152; Antisense; TGAGGATTAACCCACAGCACACCAT
>probe:Drosophila_2:1624793_at:155:459; Interrogation_Position=197; Antisense; GATTTGTCATCTGGGAGTCGCGTGC
>probe:Drosophila_2:1624793_at:172:197; Interrogation_Position=277; Antisense; AACGATCCCCAGAAGCGGGCTTTGA
>probe:Drosophila_2:1624793_at:429:291; Interrogation_Position=292; Antisense; CGGGCTTTGATCAACCAGAGGCTTT
>probe:Drosophila_2:1624793_at:315:413; Interrogation_Position=348; Antisense; GACCAAATACTTCTTCCTAATCTTC
>probe:Drosophila_2:1624793_at:654:279; Interrogation_Position=364; Antisense; CTAATCTTCCGCACTGGCAAATTCG
>probe:Drosophila_2:1624793_at:540:297; Interrogation_Position=406; Antisense; GACAAGGTTAACTCCGCCTTTGGAT
>probe:Drosophila_2:1624793_at:227:411; Interrogation_Position=452; Antisense; GTCAGGACTTCGTGGCCGGTAGCCA
>probe:Drosophila_2:1624793_at:242:193; Interrogation_Position=476; Antisense; AACTGACCGTGGCTGATATCGTCAT
>probe:Drosophila_2:1624793_at:411:311; Interrogation_Position=505; Antisense; GCCACCGTATCCACCGTAGAATGGT
>probe:Drosophila_2:1624793_at:50:371; Interrogation_Position=523; Antisense; GAATGGTTTTCGTTTGACCTAAGCA
>probe:Drosophila_2:1624793_at:376:107; Interrogation_Position=544; Antisense; AGCAAGTTCCCCAACGTGGAGAGGT
>probe:Drosophila_2:1624793_at:459:209; Interrogation_Position=574; Antisense; AAGAATGCCCCAAAAGTAACTCCTG
>probe:Drosophila_2:1624793_at:60:217; Interrogation_Position=637; Antisense; AAGTTCCTGCAGGACCTTCAAGCGG

Paste this into a BLAST search page for me
TGAGGATTAACCCACAGCACACCATGATTTGTCATCTGGGAGTCGCGTGCAACGATCCCCAGAAGCGGGCTTTGACGGGCTTTGATCAACCAGAGGCTTTGACCAAATACTTCTTCCTAATCTTCCTAATCTTCCGCACTGGCAAATTCGGACAAGGTTAACTCCGCCTTTGGATGTCAGGACTTCGTGGCCGGTAGCCAAACTGACCGTGGCTGATATCGTCATGCCACCGTATCCACCGTAGAATGGTGAATGGTTTTCGTTTGACCTAAGCAAGCAAGTTCCCCAACGTGGAGAGGTAAGAATGCCCCAAAAGTAACTCCTGAAGTTCCTGCAGGACCTTCAAGCGG

Full Affymetrix probeset data:

Annotations for 1624793_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720