Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624794_at:

>probe:Drosophila_2:1624794_at:633:115; Interrogation_Position=1369; Antisense; AGCTTCGCCAGCTGACCAAATTGTT
>probe:Drosophila_2:1624794_at:671:161; Interrogation_Position=1386; Antisense; AAATTGTTCGATTCCCTATGCCAGG
>probe:Drosophila_2:1624794_at:95:683; Interrogation_Position=1402; Antisense; TATGCCAGGCAACTCAACGATGGTT
>probe:Drosophila_2:1624794_at:557:541; Interrogation_Position=1423; Antisense; GGTTGCACCGGAAAACATCGCGTCT
>probe:Drosophila_2:1624794_at:28:191; Interrogation_Position=1436; Antisense; AACATCGCGTCTTCCGCAGAAGGAT
>probe:Drosophila_2:1624794_at:555:409; Interrogation_Position=1481; Antisense; GACGAATCCGGTGGAAGACCCTAGT
>probe:Drosophila_2:1624794_at:553:477; Interrogation_Position=1504; Antisense; GTTTGTAGTACTTTGCACTCGGCTC
>probe:Drosophila_2:1624794_at:380:661; Interrogation_Position=1546; Antisense; TAAAGGTCAGCCAGTCAACCGTCTT
>probe:Drosophila_2:1624794_at:288:713; Interrogation_Position=1572; Antisense; TTCTTCAGGTTTTGCCAGCACCAAA
>probe:Drosophila_2:1624794_at:424:491; Interrogation_Position=1618; Antisense; GTCACGAACCATTTGGAGCCATCTC
>probe:Drosophila_2:1624794_at:681:609; Interrogation_Position=1667; Antisense; TGACTGTGCCACTTTGCCATTTAGC
>probe:Drosophila_2:1624794_at:469:415; Interrogation_Position=1707; Antisense; GAGCCAATGGCTGTCGGCAAGTTTG
>probe:Drosophila_2:1624794_at:722:717; Interrogation_Position=1751; Antisense; TTCCCGCCAGTTTTACGCTGTGATA
>probe:Drosophila_2:1624794_at:572:499; Interrogation_Position=1831; Antisense; GTCTGCTTAATCTGTGCGTATCTCT

Paste this into a BLAST search page for me
AGCTTCGCCAGCTGACCAAATTGTTAAATTGTTCGATTCCCTATGCCAGGTATGCCAGGCAACTCAACGATGGTTGGTTGCACCGGAAAACATCGCGTCTAACATCGCGTCTTCCGCAGAAGGATGACGAATCCGGTGGAAGACCCTAGTGTTTGTAGTACTTTGCACTCGGCTCTAAAGGTCAGCCAGTCAACCGTCTTTTCTTCAGGTTTTGCCAGCACCAAAGTCACGAACCATTTGGAGCCATCTCTGACTGTGCCACTTTGCCATTTAGCGAGCCAATGGCTGTCGGCAAGTTTGTTCCCGCCAGTTTTACGCTGTGATAGTCTGCTTAATCTGTGCGTATCTCT

Full Affymetrix probeset data:

Annotations for 1624794_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime