FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624795_at:

>probe:Drosophila_2:1624795_at:486:653; Interrogation_Position=1213; Antisense; TAATATACCGCCACCGCAGTTTGTG
>probe:Drosophila_2:1624795_at:8:521; Interrogation_Position=1235; Antisense; GTGGAGACACAGTACCGGGCACCAA
>probe:Drosophila_2:1624795_at:96:255; Interrogation_Position=1257; Antisense; CAACGATCGCCGGTAGGGACGACTC
>probe:Drosophila_2:1624795_at:75:411; Interrogation_Position=1274; Antisense; GACGACTCCGAGCATACGCAGATGA
>probe:Drosophila_2:1624795_at:502:99; Interrogation_Position=1293; Antisense; AGATGATCGGCGACGGAGCCTTCGC
>probe:Drosophila_2:1624795_at:343:639; Interrogation_Position=1321; Antisense; TCGGTATCCGACTTTCCAGTTTAAT
>probe:Drosophila_2:1624795_at:716:311; Interrogation_Position=1360; Antisense; GCCAGCTAGCCAGTGATTGAATCTC
>probe:Drosophila_2:1624795_at:407:367; Interrogation_Position=1378; Antisense; GAATCTCTAAGCTAGACCCACAATG
>probe:Drosophila_2:1624795_at:46:443; Interrogation_Position=1418; Antisense; GATGTCGAACTATTTTCTTCTGGCT
>probe:Drosophila_2:1624795_at:677:645; Interrogation_Position=1433; Antisense; TCTTCTGGCTGTCTCTGTTTCTGGA
>probe:Drosophila_2:1624795_at:214:599; Interrogation_Position=1448; Antisense; TGTTTCTGGAGGGTTAGCTTTCGCA
>probe:Drosophila_2:1624795_at:632:341; Interrogation_Position=1464; Antisense; GCTTTCGCAATTTTTATCGGCTTTG
>probe:Drosophila_2:1624795_at:727:393; Interrogation_Position=1496; Antisense; GAAATATTAGCTTTCCGTCCAAATA
>probe:Drosophila_2:1624795_at:207:505; Interrogation_Position=1757; Antisense; GTGCCTAAAACTGATGTACGACTAT

Paste this into a BLAST search page for me
TAATATACCGCCACCGCAGTTTGTGGTGGAGACACAGTACCGGGCACCAACAACGATCGCCGGTAGGGACGACTCGACGACTCCGAGCATACGCAGATGAAGATGATCGGCGACGGAGCCTTCGCTCGGTATCCGACTTTCCAGTTTAATGCCAGCTAGCCAGTGATTGAATCTCGAATCTCTAAGCTAGACCCACAATGGATGTCGAACTATTTTCTTCTGGCTTCTTCTGGCTGTCTCTGTTTCTGGATGTTTCTGGAGGGTTAGCTTTCGCAGCTTTCGCAATTTTTATCGGCTTTGGAAATATTAGCTTTCCGTCCAAATAGTGCCTAAAACTGATGTACGACTAT

Full Affymetrix probeset data:

Annotations for 1624795_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720