FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624796_at:

>probe:Drosophila_2:1624796_at:619:303; Interrogation_Position=2064; Antisense; CCGCAATCATGATCTCTACGAGCTA
>probe:Drosophila_2:1624796_at:298:669; Interrogation_Position=2080; Antisense; TACGAGCTAAGTACGGGCGGTTACA
>probe:Drosophila_2:1624796_at:294:575; Interrogation_Position=2115; Antisense; GGCGGATCACAATCTTACCAGCATA
>probe:Drosophila_2:1624796_at:50:285; Interrogation_Position=2167; Antisense; CTGCTGATCGGCCAGAGTCACGGAA
>probe:Drosophila_2:1624796_at:643:89; Interrogation_Position=2182; Antisense; AGTCACGGAACATTCGTATCGCGAA
>probe:Drosophila_2:1624796_at:244:23; Interrogation_Position=2209; Antisense; ATAGAGGTAACCAGCCCCAATTCGA
>probe:Drosophila_2:1624796_at:544:87; Interrogation_Position=2324; Antisense; AGTCGCCGCCCAGCATGAAAAGTGT
>probe:Drosophila_2:1624796_at:129:579; Interrogation_Position=2376; Antisense; GGCCTTCGGCAACGTTATCGTCGTG
>probe:Drosophila_2:1624796_at:431:41; Interrogation_Position=2392; Antisense; ATCGTCGTGGTTGTGGCGGAACTCA
>probe:Drosophila_2:1624796_at:576:603; Interrogation_Position=2450; Antisense; TGTTCGCTGGCCTCATGTTTGTCGA
>probe:Drosophila_2:1624796_at:635:59; Interrogation_Position=2464; Antisense; ATGTTTGTCGACATGCTGGTCTTCA
>probe:Drosophila_2:1624796_at:517:269; Interrogation_Position=2487; Antisense; CATGTTCGTGGCCTACTACTATAAG
>probe:Drosophila_2:1624796_at:479:167; Interrogation_Position=2566; Antisense; AAATGGCAGGATCTCGACCGATTCA
>probe:Drosophila_2:1624796_at:439:677; Interrogation_Position=2599; Antisense; TAGGAATACGGATGCCTGATTGTCA

Paste this into a BLAST search page for me
CCGCAATCATGATCTCTACGAGCTATACGAGCTAAGTACGGGCGGTTACAGGCGGATCACAATCTTACCAGCATACTGCTGATCGGCCAGAGTCACGGAAAGTCACGGAACATTCGTATCGCGAAATAGAGGTAACCAGCCCCAATTCGAAGTCGCCGCCCAGCATGAAAAGTGTGGCCTTCGGCAACGTTATCGTCGTGATCGTCGTGGTTGTGGCGGAACTCATGTTCGCTGGCCTCATGTTTGTCGAATGTTTGTCGACATGCTGGTCTTCACATGTTCGTGGCCTACTACTATAAGAAATGGCAGGATCTCGACCGATTCATAGGAATACGGATGCCTGATTGTCA

Full Affymetrix probeset data:

Annotations for 1624796_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720