FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624797_at:

>probe:Drosophila_2:1624797_at:543:129; Interrogation_Position=1111; Antisense; ACCGGAAGAAGCGTCCCTGGATTAT
>probe:Drosophila_2:1624797_at:5:591; Interrogation_Position=1128; Antisense; TGGATTATCACATACGGCCATCGGC
>probe:Drosophila_2:1624797_at:246:161; Interrogation_Position=1200; Antisense; ACAATCGTTCGAAAGGGTCTGCCCA
>probe:Drosophila_2:1624797_at:724:49; Interrogation_Position=1224; Antisense; ATGCTGGATTTCTTCGGGCTGGAGC
>probe:Drosophila_2:1624797_at:76:587; Interrogation_Position=1243; Antisense; TGGAGCCACTCTTTTATCAGTACGG
>probe:Drosophila_2:1624797_at:117:331; Interrogation_Position=1307; Antisense; GCGGATGTGGCCCATGTACAACTAC
>probe:Drosophila_2:1624797_at:21:133; Interrogation_Position=1332; Antisense; ACCGTGTTCAATGGATCGCTGGCCG
>probe:Drosophila_2:1624797_at:305:63; Interrogation_Position=1363; Antisense; ATGTGAATCCCGGTGCACCAATACA
>probe:Drosophila_2:1624797_at:141:31; Interrogation_Position=1383; Antisense; ATACACATCATTTCGGGAGCTGCCG
>probe:Drosophila_2:1624797_at:442:81; Interrogation_Position=1422; Antisense; AGGGAGCCATTCTTCAAGCGCATGC
>probe:Drosophila_2:1624797_at:505:73; Interrogation_Position=1471; Antisense; AGGACTTTGGGTATCTTCGACTGAA
>probe:Drosophila_2:1624797_at:704:565; Interrogation_Position=1506; Antisense; GGCACCCATCTACATTTCGAGCAGG
>probe:Drosophila_2:1624797_at:474:497; Interrogation_Position=1554; Antisense; GTCATCGATAGTTTCTGGGTGGTCA
>probe:Drosophila_2:1624797_at:560:65; Interrogation_Position=1588; Antisense; ATGGACCGTACCAGTCTGATCTCAA

Paste this into a BLAST search page for me
ACCGGAAGAAGCGTCCCTGGATTATTGGATTATCACATACGGCCATCGGCACAATCGTTCGAAAGGGTCTGCCCAATGCTGGATTTCTTCGGGCTGGAGCTGGAGCCACTCTTTTATCAGTACGGGCGGATGTGGCCCATGTACAACTACACCGTGTTCAATGGATCGCTGGCCGATGTGAATCCCGGTGCACCAATACAATACACATCATTTCGGGAGCTGCCGAGGGAGCCATTCTTCAAGCGCATGCAGGACTTTGGGTATCTTCGACTGAAGGCACCCATCTACATTTCGAGCAGGGTCATCGATAGTTTCTGGGTGGTCAATGGACCGTACCAGTCTGATCTCAA

Full Affymetrix probeset data:

Annotations for 1624797_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720