FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624800_at:

>probe:Drosophila_2:1624800_at:63:167; Interrogation_Position=202; Antisense; AAATCCGCCGAGTTTCTCAAGTTGA
>probe:Drosophila_2:1624800_at:349:455; Interrogation_Position=256; Antisense; GATAACGGCACCATCGTGAGCGATT
>probe:Drosophila_2:1624800_at:10:329; Interrogation_Position=275; Antisense; GCGATTCGCACATTATCTGCAGCTA
>probe:Drosophila_2:1624800_at:588:685; Interrogation_Position=298; Antisense; TATCTGGCAGATAAGTACGCACCGG
>probe:Drosophila_2:1624800_at:665:431; Interrogation_Position=322; Antisense; GAGGGCGATGATTCCCTGTATCCAA
>probe:Drosophila_2:1624800_at:494:545; Interrogation_Position=372; Antisense; GGATGCCCGTTTGTACTACGATTGC
>probe:Drosophila_2:1624800_at:219:687; Interrogation_Position=404; Antisense; TATTCCCGCGAATCCGTTTCATTGT
>probe:Drosophila_2:1624800_at:18:697; Interrogation_Position=420; Antisense; TTTCATTGTCGAGCCGGTGATCTAT
>probe:Drosophila_2:1624800_at:265:689; Interrogation_Position=442; Antisense; TATTTCGGAGCTGGCGAGGTGCCCA
>probe:Drosophila_2:1624800_at:553:435; Interrogation_Position=469; Antisense; GATCGAGTGGCCTACCTTCAGAAGG
>probe:Drosophila_2:1624800_at:339:67; Interrogation_Position=500; Antisense; ATGGCTTGGAGCACTGTCTGGCTGA
>probe:Drosophila_2:1624800_at:637:701; Interrogation_Position=600; Antisense; TTTTGCGCCAATCGAGCCGGATCAG
>probe:Drosophila_2:1624800_at:145:543; Interrogation_Position=618; Antisense; GGATCAGTTTCCACGCCTGGTACAG
>probe:Drosophila_2:1624800_at:500:153; Interrogation_Position=639; Antisense; ACAGTGGGTCAAGCGCATTCAGGCC

Paste this into a BLAST search page for me
AAATCCGCCGAGTTTCTCAAGTTGAGATAACGGCACCATCGTGAGCGATTGCGATTCGCACATTATCTGCAGCTATATCTGGCAGATAAGTACGCACCGGGAGGGCGATGATTCCCTGTATCCAAGGATGCCCGTTTGTACTACGATTGCTATTCCCGCGAATCCGTTTCATTGTTTTCATTGTCGAGCCGGTGATCTATTATTTCGGAGCTGGCGAGGTGCCCAGATCGAGTGGCCTACCTTCAGAAGGATGGCTTGGAGCACTGTCTGGCTGATTTTGCGCCAATCGAGCCGGATCAGGGATCAGTTTCCACGCCTGGTACAGACAGTGGGTCAAGCGCATTCAGGCC

Full Affymetrix probeset data:

Annotations for 1624800_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720