FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624801_at:

>probe:Drosophila_2:1624801_at:305:207; Interrogation_Position=372; Antisense; AAGCGGCGCGTAAATCGACTCAATT
>probe:Drosophila_2:1624801_at:330:49; Interrogation_Position=422; Antisense; ATGCCCAAAAATAGATCCCTGCCTG
>probe:Drosophila_2:1624801_at:457:449; Interrogation_Position=435; Antisense; GATCCCTGCCTGGATGATCATATAT
>probe:Drosophila_2:1624801_at:498:93; Interrogation_Position=479; Antisense; AGTTCATCCCGAAATTCTTCAGCTG
>probe:Drosophila_2:1624801_at:95:645; Interrogation_Position=494; Antisense; TCTTCAGCTGAAGTTTGCAAGCCAT
>probe:Drosophila_2:1624801_at:512:147; Interrogation_Position=521; Antisense; ACTACAGCACCAACTGACTCAGATG
>probe:Drosophila_2:1624801_at:253:405; Interrogation_Position=536; Antisense; GACTCAGATGCAATCCGTCCGAAGA
>probe:Drosophila_2:1624801_at:399:503; Interrogation_Position=552; Antisense; GTCCGAAGATCATCCAATCTGGCCA
>probe:Drosophila_2:1624801_at:141:145; Interrogation_Position=651; Antisense; GACTCCTTTAAGCTCAAATTCGAAA
>probe:Drosophila_2:1624801_at:300:223; Interrogation_Position=682; Antisense; AAGGACTATGTCTTCAACGGTTTAG
>probe:Drosophila_2:1624801_at:362:125; Interrogation_Position=833; Antisense; AGCCGCTAGGGTGACAATCTCTTTA
>probe:Drosophila_2:1624801_at:39:187; Interrogation_Position=860; Antisense; AACAGCCGCGGAAAATTTGCAAGAT
>probe:Drosophila_2:1624801_at:616:387; Interrogation_Position=935; Antisense; GAAAAATTCCTGTGTATCCATTCGT
>probe:Drosophila_2:1624801_at:503:515; Interrogation_Position=946; Antisense; GTGTATCCATTCGTTCAGACCTTTA

Paste this into a BLAST search page for me
AAGCGGCGCGTAAATCGACTCAATTATGCCCAAAAATAGATCCCTGCCTGGATCCCTGCCTGGATGATCATATATAGTTCATCCCGAAATTCTTCAGCTGTCTTCAGCTGAAGTTTGCAAGCCATACTACAGCACCAACTGACTCAGATGGACTCAGATGCAATCCGTCCGAAGAGTCCGAAGATCATCCAATCTGGCCAGACTCCTTTAAGCTCAAATTCGAAAAAGGACTATGTCTTCAACGGTTTAGAGCCGCTAGGGTGACAATCTCTTTAAACAGCCGCGGAAAATTTGCAAGATGAAAAATTCCTGTGTATCCATTCGTGTGTATCCATTCGTTCAGACCTTTA

Full Affymetrix probeset data:

Annotations for 1624801_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720