Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624803_at:

>probe:Drosophila_2:1624803_at:444:169; Interrogation_Position=1935; Antisense; AAAGTCGTTATCTAATGTGGGCCAA
>probe:Drosophila_2:1624803_at:255:331; Interrogation_Position=1980; Antisense; GCGGAGTCGATCTAAAAGCCAAAAT
>probe:Drosophila_2:1624803_at:168:539; Interrogation_Position=2045; Antisense; GGTATCCGTCGGAACATTTTTTATG
>probe:Drosophila_2:1624803_at:299:33; Interrogation_Position=2073; Antisense; ATCAGAGTCTGGTGAATCTTTTCAA
>probe:Drosophila_2:1624803_at:380:237; Interrogation_Position=2246; Antisense; AATCATTGACTACAAGCTTCTTTGA
>probe:Drosophila_2:1624803_at:294:215; Interrogation_Position=2282; Antisense; AAGATGATCAGAATCCTCGCTCAGT
>probe:Drosophila_2:1624803_at:648:305; Interrogation_Position=2296; Antisense; CCTCGCTCAGTATTGTTCGGAACTT
>probe:Drosophila_2:1624803_at:233:641; Interrogation_Position=2312; Antisense; TCGGAACTTCTTTGGAATGTTGCTT
>probe:Drosophila_2:1624803_at:346:563; Interrogation_Position=2367; Antisense; GGAAGACCGATCTAAGTATTCACTT
>probe:Drosophila_2:1624803_at:15:483; Interrogation_Position=2382; Antisense; GTATTCACTTCTGTCAATGTTTCGT
>probe:Drosophila_2:1624803_at:615:485; Interrogation_Position=2417; Antisense; GTACGCCAGGAAGTGTTTTGAAGCT
>probe:Drosophila_2:1624803_at:263:101; Interrogation_Position=2462; Antisense; AGAGCATCAATTCTCACAACTGGAT
>probe:Drosophila_2:1624803_at:395:195; Interrogation_Position=2479; Antisense; AACTGGATGCTTACCGAACACCTAC
>probe:Drosophila_2:1624803_at:259:383; Interrogation_Position=2494; Antisense; GAACACCTACGGGATTCAGAAGTTT

Paste this into a BLAST search page for me
AAAGTCGTTATCTAATGTGGGCCAAGCGGAGTCGATCTAAAAGCCAAAATGGTATCCGTCGGAACATTTTTTATGATCAGAGTCTGGTGAATCTTTTCAAAATCATTGACTACAAGCTTCTTTGAAAGATGATCAGAATCCTCGCTCAGTCCTCGCTCAGTATTGTTCGGAACTTTCGGAACTTCTTTGGAATGTTGCTTGGAAGACCGATCTAAGTATTCACTTGTATTCACTTCTGTCAATGTTTCGTGTACGCCAGGAAGTGTTTTGAAGCTAGAGCATCAATTCTCACAACTGGATAACTGGATGCTTACCGAACACCTACGAACACCTACGGGATTCAGAAGTTT

Full Affymetrix probeset data:

Annotations for 1624803_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime