FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624805_at:

>probe:Drosophila_2:1624805_at:332:93; Interrogation_Position=124; Antisense; AGTTCTCCGGCCATGCGATCGGATC
>probe:Drosophila_2:1624805_at:693:451; Interrogation_Position=140; Antisense; GATCGGATCTCTTCAACGTCGAATG
>probe:Drosophila_2:1624805_at:155:633; Interrogation_Position=158; Antisense; TCGAATGCGTGGACTACTACAGCCC
>probe:Drosophila_2:1624805_at:318:291; Interrogation_Position=182; Antisense; CGCTCCTTAAGGGTCACGTGGACAA
>probe:Drosophila_2:1624805_at:610:217; Interrogation_Position=205; Antisense; AAGTACAACGAGGACTTCACCGCGT
>probe:Drosophila_2:1624805_at:725:273; Interrogation_Position=219; Antisense; CTTCACCGCGTGCAAGGACAATTAC
>probe:Drosophila_2:1624805_at:466:601; Interrogation_Position=260; Antisense; TGATCGACTCAAGCTACCGCAGTTC
>probe:Drosophila_2:1624805_at:549:297; Interrogation_Position=286; Antisense; CGCGACGAGCTGTCCGTATCCGTGA
>probe:Drosophila_2:1624805_at:535:483; Interrogation_Position=301; Antisense; GTATCCGTGAGGGACACCTGCCTTT
>probe:Drosophila_2:1624805_at:316:227; Interrogation_Position=340; Antisense; AATGGCAGGACCTCGAACTCCGATG
>probe:Drosophila_2:1624805_at:248:699; Interrogation_Position=35; Antisense; TTTTGTTGGCTATCGGCGCCGTCTT
>probe:Drosophila_2:1624805_at:488:193; Interrogation_Position=355; Antisense; AACTCCGATGCCTTCGAGTGCTTGG
>probe:Drosophila_2:1624805_at:603:423; Interrogation_Position=390; Antisense; GAGTGATTCGTACAATGGTGGCTTA
>probe:Drosophila_2:1624805_at:415:571; Interrogation_Position=409; Antisense; GGCTTAATCTATGATCTTCCACGCA

Paste this into a BLAST search page for me
AGTTCTCCGGCCATGCGATCGGATCGATCGGATCTCTTCAACGTCGAATGTCGAATGCGTGGACTACTACAGCCCCGCTCCTTAAGGGTCACGTGGACAAAAGTACAACGAGGACTTCACCGCGTCTTCACCGCGTGCAAGGACAATTACTGATCGACTCAAGCTACCGCAGTTCCGCGACGAGCTGTCCGTATCCGTGAGTATCCGTGAGGGACACCTGCCTTTAATGGCAGGACCTCGAACTCCGATGTTTTGTTGGCTATCGGCGCCGTCTTAACTCCGATGCCTTCGAGTGCTTGGGAGTGATTCGTACAATGGTGGCTTAGGCTTAATCTATGATCTTCCACGCA

Full Affymetrix probeset data:

Annotations for 1624805_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720