FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624806_at:

>probe:Drosophila_2:1624806_at:591:219; Interrogation_Position=1064; Antisense; AAGTGCTCCCGGGTCACAAGCGATT
>probe:Drosophila_2:1624806_at:556:63; Interrogation_Position=1090; Antisense; ATGTGGGCGCTGGAGAGCAACTTCC
>probe:Drosophila_2:1624806_at:414:421; Interrogation_Position=1104; Antisense; GAGCAACTTCCACGATTTCATCTCG
>probe:Drosophila_2:1624806_at:696:17; Interrogation_Position=1118; Antisense; ATTTCATCTCGGATCGCACGGGCTG
>probe:Drosophila_2:1624806_at:451:61; Interrogation_Position=1182; Antisense; ATGTGACGATTGAGTCCGTATCCCT
>probe:Drosophila_2:1624806_at:671:631; Interrogation_Position=1202; Antisense; TCCCTCCACTTTCTTAGGCTTAAGA
>probe:Drosophila_2:1624806_at:71:459; Interrogation_Position=1235; Antisense; GATTTGTTGTCGTTACTGGGTCTCA
>probe:Drosophila_2:1624806_at:1:591; Interrogation_Position=683; Antisense; TGGTATACGACATCACCGGCAACAA
>probe:Drosophila_2:1624806_at:211:443; Interrogation_Position=751; Antisense; GATGTGCTGTACGTGGCGCTCACCT
>probe:Drosophila_2:1624806_at:108:293; Interrogation_Position=826; Antisense; CGTCTGTACTCCATCAAGGGCGAGT
>probe:Drosophila_2:1624806_at:712:203; Interrogation_Position=898; Antisense; AAGCCCTATGGCAAACAGGCGGTGC
>probe:Drosophila_2:1624806_at:340:645; Interrogation_Position=950; Antisense; TCTTCTTCCGCTACAAGGGCGAGAA
>probe:Drosophila_2:1624806_at:310:107; Interrogation_Position=971; Antisense; AGAACGACATTTACCTGTGGGACTC
>probe:Drosophila_2:1624806_at:281:593; Interrogation_Position=988; Antisense; TGGGACTCGGAGACCTGCTTCAAGG

Paste this into a BLAST search page for me
AAGTGCTCCCGGGTCACAAGCGATTATGTGGGCGCTGGAGAGCAACTTCCGAGCAACTTCCACGATTTCATCTCGATTTCATCTCGGATCGCACGGGCTGATGTGACGATTGAGTCCGTATCCCTTCCCTCCACTTTCTTAGGCTTAAGAGATTTGTTGTCGTTACTGGGTCTCATGGTATACGACATCACCGGCAACAAGATGTGCTGTACGTGGCGCTCACCTCGTCTGTACTCCATCAAGGGCGAGTAAGCCCTATGGCAAACAGGCGGTGCTCTTCTTCCGCTACAAGGGCGAGAAAGAACGACATTTACCTGTGGGACTCTGGGACTCGGAGACCTGCTTCAAGG

Full Affymetrix probeset data:

Annotations for 1624806_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720