Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624807_at:

>probe:Drosophila_2:1624807_at:525:471; Interrogation_Position=3554; Antisense; GTTCAACAACTCTTCAAGTCATCTA
>probe:Drosophila_2:1624807_at:5:395; Interrogation_Position=3586; Antisense; GAAATCTATTCTCTATACATACAAT
>probe:Drosophila_2:1624807_at:404:153; Interrogation_Position=3611; Antisense; ACATGTACTATATTATCCAAGAGGG
>probe:Drosophila_2:1624807_at:713:683; Interrogation_Position=3673; Antisense; TATCCAATTTGGACCAACCGATAAG
>probe:Drosophila_2:1624807_at:331:515; Interrogation_Position=3768; Antisense; GTGTATATCTCGATGTATACCTTTA
>probe:Drosophila_2:1624807_at:313:17; Interrogation_Position=3814; Antisense; ATTTCCATTGAATATTTACTCTCTA
>probe:Drosophila_2:1624807_at:231:709; Interrogation_Position=3829; Antisense; TTACTCTCTACAAGCATTTTGCCCT
>probe:Drosophila_2:1624807_at:38:111; Interrogation_Position=3841; Antisense; AGCATTTTGCCCTCTAAGCTAGATA
>probe:Drosophila_2:1624807_at:338:235; Interrogation_Position=3901; Antisense; AATCCAATTGTACGCAATGCAGTTT
>probe:Drosophila_2:1624807_at:342:233; Interrogation_Position=3916; Antisense; AATGCAGTTTTGGTCACTGCACCTG
>probe:Drosophila_2:1624807_at:114:301; Interrogation_Position=3941; Antisense; CCCTCTTTCTTACCGGAATCCATGA
>probe:Drosophila_2:1624807_at:394:367; Interrogation_Position=3956; Antisense; GAATCCATGAGCTGTTTAACTGTAA
>probe:Drosophila_2:1624807_at:356:167; Interrogation_Position=4005; Antisense; AAATGTACCATATGCCGTACTAAGG
>probe:Drosophila_2:1624807_at:183:317; Interrogation_Position=4018; Antisense; GCCGTACTAAGGTCTAGTATCCATA

Paste this into a BLAST search page for me
GTTCAACAACTCTTCAAGTCATCTAGAAATCTATTCTCTATACATACAATACATGTACTATATTATCCAAGAGGGTATCCAATTTGGACCAACCGATAAGGTGTATATCTCGATGTATACCTTTAATTTCCATTGAATATTTACTCTCTATTACTCTCTACAAGCATTTTGCCCTAGCATTTTGCCCTCTAAGCTAGATAAATCCAATTGTACGCAATGCAGTTTAATGCAGTTTTGGTCACTGCACCTGCCCTCTTTCTTACCGGAATCCATGAGAATCCATGAGCTGTTTAACTGTAAAAATGTACCATATGCCGTACTAAGGGCCGTACTAAGGTCTAGTATCCATA

Full Affymetrix probeset data:

Annotations for 1624807_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime