FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624808_at:

>probe:Drosophila_2:1624808_at:270:255; Interrogation_Position=112; Antisense; CAAACTTTAGTGCTCTTCGATGGAC
>probe:Drosophila_2:1624808_at:174:139; Interrogation_Position=142; Antisense; ACGATTGGCCGGGAGAGAGCTCTTA
>probe:Drosophila_2:1624808_at:475:545; Interrogation_Position=169; Antisense; GGATCCTTCAAATTCCTCGGTGAGA
>probe:Drosophila_2:1624808_at:373:403; Interrogation_Position=205; Antisense; GACTTCAAGGTATCCGTGGAGCTCT
>probe:Drosophila_2:1624808_at:46:587; Interrogation_Position=221; Antisense; TGGAGCTCTATTCAAGCCCCAATGG
>probe:Drosophila_2:1624808_at:171:441; Interrogation_Position=264; Antisense; GATGGTCATGGATGTGCCGCAAACT
>probe:Drosophila_2:1624808_at:256:473; Interrogation_Position=312; Antisense; GTTCTATGTCCAGTTTGTGCAACCC
>probe:Drosophila_2:1624808_at:727:595; Interrogation_Position=327; Antisense; TGTGCAACCCTCTCTGAAGACTGGA
>probe:Drosophila_2:1624808_at:253:257; Interrogation_Position=359; Antisense; CAAATTTCCCCGTTGTCGACGATGA
>probe:Drosophila_2:1624808_at:564:29; Interrogation_Position=380; Antisense; ATGACTTTTGCCCAGTGCCCGAAGG
>probe:Drosophila_2:1624808_at:688:501; Interrogation_Position=394; Antisense; GTGCCCGAAGGCGAATTCTACGTTA
>probe:Drosophila_2:1624808_at:90:27; Interrogation_Position=434; Antisense; ATACGCAAGATTGGCCATCGCAGGT
>probe:Drosophila_2:1624808_at:601:297; Interrogation_Position=452; Antisense; CGCAGGTGCCTCGAGGGATTGTCAA
>probe:Drosophila_2:1624808_at:537:31; Interrogation_Position=484; Antisense; ATAACATTCTTCAGTGGTGGCAAAA

Paste this into a BLAST search page for me
CAAACTTTAGTGCTCTTCGATGGACACGATTGGCCGGGAGAGAGCTCTTAGGATCCTTCAAATTCCTCGGTGAGAGACTTCAAGGTATCCGTGGAGCTCTTGGAGCTCTATTCAAGCCCCAATGGGATGGTCATGGATGTGCCGCAAACTGTTCTATGTCCAGTTTGTGCAACCCTGTGCAACCCTCTCTGAAGACTGGACAAATTTCCCCGTTGTCGACGATGAATGACTTTTGCCCAGTGCCCGAAGGGTGCCCGAAGGCGAATTCTACGTTAATACGCAAGATTGGCCATCGCAGGTCGCAGGTGCCTCGAGGGATTGTCAAATAACATTCTTCAGTGGTGGCAAAA

Full Affymetrix probeset data:

Annotations for 1624808_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720