FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624810_at:

>probe:Drosophila_2:1624810_at:592:205; Interrogation_Position=1016; Antisense; AAGCTTCAACAACATCGCAGTCCGA
>probe:Drosophila_2:1624810_at:663:503; Interrogation_Position=1035; Antisense; GTCCGAAATAACAACCACTCCTGCA
>probe:Drosophila_2:1624810_at:164:617; Interrogation_Position=1056; Antisense; TGCACCGACGAGCAGCACTGAAATA
>probe:Drosophila_2:1624810_at:631:5; Interrogation_Position=1144; Antisense; ATTGCTTACACCGTTTACACCATGG
>probe:Drosophila_2:1624810_at:263:665; Interrogation_Position=1159; Antisense; TACACCATGGAACCCTATCCGAATA
>probe:Drosophila_2:1624810_at:288:687; Interrogation_Position=1182; Antisense; TATATATGGCCGATCGAACGAGATT
>probe:Drosophila_2:1624810_at:482:381; Interrogation_Position=1197; Antisense; GAACGAGATTGCCAAGCCACAGCGA
>probe:Drosophila_2:1624810_at:176:267; Interrogation_Position=1326; Antisense; CAGGACGACGTTGAGTGGCTTTGAC
>probe:Drosophila_2:1624810_at:460:571; Interrogation_Position=1342; Antisense; GGCTTTGACGATTTCAGCGAGGACT
>probe:Drosophila_2:1624810_at:193:75; Interrogation_Position=1361; Antisense; AGGACTACGACGATCTCGTCCTCAA
>probe:Drosophila_2:1624810_at:653:289; Interrogation_Position=1377; Antisense; CGTCCTCAACTCGAACAACGTATTG
>probe:Drosophila_2:1624810_at:637:689; Interrogation_Position=1397; Antisense; TATTGGAACCATTTCCGGAGTTGCC
>probe:Drosophila_2:1624810_at:203:429; Interrogation_Position=1414; Antisense; GAGTTGCCCCTCGACTTAGGAAATA
>probe:Drosophila_2:1624810_at:172:39; Interrogation_Position=1438; Antisense; ATCGACAACAACAGAATCCCCAAGT

Paste this into a BLAST search page for me
AAGCTTCAACAACATCGCAGTCCGAGTCCGAAATAACAACCACTCCTGCATGCACCGACGAGCAGCACTGAAATAATTGCTTACACCGTTTACACCATGGTACACCATGGAACCCTATCCGAATATATATATGGCCGATCGAACGAGATTGAACGAGATTGCCAAGCCACAGCGACAGGACGACGTTGAGTGGCTTTGACGGCTTTGACGATTTCAGCGAGGACTAGGACTACGACGATCTCGTCCTCAACGTCCTCAACTCGAACAACGTATTGTATTGGAACCATTTCCGGAGTTGCCGAGTTGCCCCTCGACTTAGGAAATAATCGACAACAACAGAATCCCCAAGT

Full Affymetrix probeset data:

Annotations for 1624810_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720