Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624812_at:

>probe:Drosophila_2:1624812_at:191:607; Interrogation_Position=2799; Antisense; TGATGCGCCGGAAGAGTACCTCGAT
>probe:Drosophila_2:1624812_at:276:431; Interrogation_Position=2812; Antisense; GAGTACCTCGATCCGATTATCTCAA
>probe:Drosophila_2:1624812_at:225:15; Interrogation_Position=2827; Antisense; ATTATCTCAACGCTTATGACCGACC
>probe:Drosophila_2:1624812_at:226:337; Interrogation_Position=2859; Antisense; GCTGCCCAGCTCCAAGGTAACAGTG
>probe:Drosophila_2:1624812_at:626:491; Interrogation_Position=2875; Antisense; GTAACAGTGGATCGTTCCACCATCG
>probe:Drosophila_2:1624812_at:213:321; Interrogation_Position=2899; Antisense; GCCCGTCATCTTCTGAGCGATCAGA
>probe:Drosophila_2:1624812_at:634:607; Interrogation_Position=2912; Antisense; TGAGCGATCAGACCGATCCCTTTAA
>probe:Drosophila_2:1624812_at:396:323; Interrogation_Position=2939; Antisense; GCGAACCGCTCACCATGGATAAGGT
>probe:Drosophila_2:1624812_at:407:77; Interrogation_Position=2960; Antisense; AGGTCAAGTCCAACGAGGCTCTGAA
>probe:Drosophila_2:1624812_at:616:331; Interrogation_Position=3022; Antisense; GCGGCCCGCTCGAACAGTTGAGGTA
>probe:Drosophila_2:1624812_at:48:93; Interrogation_Position=3037; Antisense; AGTTGAGGTAGCAGCGAACCCGCAG
>probe:Drosophila_2:1624812_at:19:571; Interrogation_Position=3067; Antisense; GGCTCAGTTGCCCAACCAAAGAGTT
>probe:Drosophila_2:1624812_at:479:361; Interrogation_Position=3146; Antisense; GAATTCCAGTCATACATGGTGGTAT
>probe:Drosophila_2:1624812_at:498:629; Interrogation_Position=3218; Antisense; TCCATTTTTTCCTGTCAACCGAATT

Paste this into a BLAST search page for me
TGATGCGCCGGAAGAGTACCTCGATGAGTACCTCGATCCGATTATCTCAAATTATCTCAACGCTTATGACCGACCGCTGCCCAGCTCCAAGGTAACAGTGGTAACAGTGGATCGTTCCACCATCGGCCCGTCATCTTCTGAGCGATCAGATGAGCGATCAGACCGATCCCTTTAAGCGAACCGCTCACCATGGATAAGGTAGGTCAAGTCCAACGAGGCTCTGAAGCGGCCCGCTCGAACAGTTGAGGTAAGTTGAGGTAGCAGCGAACCCGCAGGGCTCAGTTGCCCAACCAAAGAGTTGAATTCCAGTCATACATGGTGGTATTCCATTTTTTCCTGTCAACCGAATT

Full Affymetrix probeset data:

Annotations for 1624812_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime