Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624815_at:

>probe:Drosophila_2:1624815_at:42:289; Interrogation_Position=1958; Antisense; CGGCGGCCAAGGACAAGCAGCGCTA
>probe:Drosophila_2:1624815_at:469:339; Interrogation_Position=1979; Antisense; GCTACCACGACGAGATGCGCAACTA
>probe:Drosophila_2:1624815_at:174:665; Interrogation_Position=2002; Antisense; TACAAGCCTGAAGCGGGCGGTGACA
>probe:Drosophila_2:1624815_at:66:371; Interrogation_Position=2037; Antisense; GAAGGGTGGAAAGTCCTCCAAGAAG
>probe:Drosophila_2:1624815_at:562:205; Interrogation_Position=2059; Antisense; AAGCGCAAGACGGAGCCTTCTCCAT
>probe:Drosophila_2:1624815_at:513:225; Interrogation_Position=2089; Antisense; AAGGCGAATACCTCGGGCAGCGGCT
>probe:Drosophila_2:1624815_at:22:263; Interrogation_Position=2106; Antisense; CAGCGGCTTCAAGAGCAAGGAGTAC
>probe:Drosophila_2:1624815_at:631:249; Interrogation_Position=2121; Antisense; CAAGGAGTACATTTCGGACGACGAC
>probe:Drosophila_2:1624815_at:657:371; Interrogation_Position=2166; Antisense; GAAGGACAACGAGCCTGCCAAGAAG
>probe:Drosophila_2:1624815_at:58:157; Interrogation_Position=2367; Antisense; ACACCCATGTCCCAAATCTAGTTTA
>probe:Drosophila_2:1624815_at:647:37; Interrogation_Position=2382; Antisense; ATCTAGTTTACATTCGCCTAGTTTA
>probe:Drosophila_2:1624815_at:442:315; Interrogation_Position=2397; Antisense; GCCTAGTTTAGTTAAGTGCTGCCTG
>probe:Drosophila_2:1624815_at:362:507; Interrogation_Position=2412; Antisense; GTGCTGCCTGTTGGATACAGACCCA
>probe:Drosophila_2:1624815_at:380:455; Interrogation_Position=2425; Antisense; GATACAGACCCATACGTTTTTGTTT

Paste this into a BLAST search page for me
CGGCGGCCAAGGACAAGCAGCGCTAGCTACCACGACGAGATGCGCAACTATACAAGCCTGAAGCGGGCGGTGACAGAAGGGTGGAAAGTCCTCCAAGAAGAAGCGCAAGACGGAGCCTTCTCCATAAGGCGAATACCTCGGGCAGCGGCTCAGCGGCTTCAAGAGCAAGGAGTACCAAGGAGTACATTTCGGACGACGACGAAGGACAACGAGCCTGCCAAGAAGACACCCATGTCCCAAATCTAGTTTAATCTAGTTTACATTCGCCTAGTTTAGCCTAGTTTAGTTAAGTGCTGCCTGGTGCTGCCTGTTGGATACAGACCCAGATACAGACCCATACGTTTTTGTTT

Full Affymetrix probeset data:

Annotations for 1624815_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime