FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624816_at:

>probe:Drosophila_2:1624816_at:340:3; Interrogation_Position=252; Antisense; ATTGAGAAAAGTCCGCCTGGGCGTA
>probe:Drosophila_2:1624816_at:372:109; Interrogation_Position=299; Antisense; AGAAGTTCGCTGTCGATGCCATGTT
>probe:Drosophila_2:1624816_at:96:449; Interrogation_Position=313; Antisense; GATGCCATGTTTGTCCACACAGATT
>probe:Drosophila_2:1624816_at:704:723; Interrogation_Position=344; Antisense; TTGACCAGCACGATTTGGCTCTTTT
>probe:Drosophila_2:1624816_at:582:571; Interrogation_Position=360; Antisense; GGCTCTTTTGAGACTGGCCAAGCGA
>probe:Drosophila_2:1624816_at:37:579; Interrogation_Position=375; Antisense; GGCCAAGCGAGTGCACTATTCAGAT
>probe:Drosophila_2:1624816_at:511:31; Interrogation_Position=403; Antisense; ATAAGTCCGATTTGTTTGCTCCTGG
>probe:Drosophila_2:1624816_at:644:631; Interrogation_Position=422; Antisense; TCCTGGACCCGCTTGTTAAAAACAT
>probe:Drosophila_2:1624816_at:207:53; Interrogation_Position=514; Antisense; ATGCTCCAGAAAACCTCGCTATTTA
>probe:Drosophila_2:1624816_at:97:711; Interrogation_Position=536; Antisense; TTAACCTTCATCGATCTGAGTGCGC
>probe:Drosophila_2:1624816_at:261:115; Interrogation_Position=563; Antisense; AGCAGTATCCGCATCAGCAGATCAA
>probe:Drosophila_2:1624816_at:63:41; Interrogation_Position=661; Antisense; ATCGTGACCTATGACCATGTCCAAA
>probe:Drosophila_2:1624816_at:8:93; Interrogation_Position=709; Antisense; AGTTTCGGACATGCGGACTGCTCCA
>probe:Drosophila_2:1624816_at:66:547; Interrogation_Position=773; Antisense; GGATCGTTAATACTGTACGCCGCGC

Paste this into a BLAST search page for me
ATTGAGAAAAGTCCGCCTGGGCGTAAGAAGTTCGCTGTCGATGCCATGTTGATGCCATGTTTGTCCACACAGATTTTGACCAGCACGATTTGGCTCTTTTGGCTCTTTTGAGACTGGCCAAGCGAGGCCAAGCGAGTGCACTATTCAGATATAAGTCCGATTTGTTTGCTCCTGGTCCTGGACCCGCTTGTTAAAAACATATGCTCCAGAAAACCTCGCTATTTATTAACCTTCATCGATCTGAGTGCGCAGCAGTATCCGCATCAGCAGATCAAATCGTGACCTATGACCATGTCCAAAAGTTTCGGACATGCGGACTGCTCCAGGATCGTTAATACTGTACGCCGCGC

Full Affymetrix probeset data:

Annotations for 1624816_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720