FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624817_at:

>probe:Drosophila_2:1624817_at:234:145; Interrogation_Position=1016; Antisense; ACTGCTCTGGTCGTTGTGGTCAGGA
>probe:Drosophila_2:1624817_at:683:365; Interrogation_Position=1084; Antisense; GAATCATGTCTGGTGAACGGCAATT
>probe:Drosophila_2:1624817_at:419:171; Interrogation_Position=1138; Antisense; AAAGATCTGGTCATAGCTCCGTATA
>probe:Drosophila_2:1624817_at:181:279; Interrogation_Position=660; Antisense; CTACTTCATGTTCGGCAGCGGAGTG
>probe:Drosophila_2:1624817_at:297:531; Interrogation_Position=684; Antisense; GGGTAGCCTGCTGGTGTCCATAAAA
>probe:Drosophila_2:1624817_at:635:299; Interrogation_Position=709; Antisense; CCCGTTTCGGTGACTATAGGAGACA
>probe:Drosophila_2:1624817_at:205:583; Interrogation_Position=799; Antisense; TGGCTGGAGCACACGATCGATATCA
>probe:Drosophila_2:1624817_at:259:73; Interrogation_Position=836; Antisense; AGGACTTCCAAGTGATCTTTACCGC
>probe:Drosophila_2:1624817_at:716:623; Interrogation_Position=867; Antisense; TGCGAGGTCCCAATACGGAGATATT
>probe:Drosophila_2:1624817_at:574:7; Interrogation_Position=889; Antisense; ATTGCCATCGACGACGTGAAGCTGA
>probe:Drosophila_2:1624817_at:685:369; Interrogation_Position=925; Antisense; GAATGTGCCAGGAGGTCTACCTTCA
>probe:Drosophila_2:1624817_at:209:435; Interrogation_Position=936; Antisense; GAGGTCTACCTTCATCGAGGAACCA
>probe:Drosophila_2:1624817_at:589:21; Interrogation_Position=983; Antisense; ATATCACGGATTCACTGGGCTACCA
>probe:Drosophila_2:1624817_at:443:593; Interrogation_Position=998; Antisense; TGGGCTACCAAATGACCGACTGCTC

Paste this into a BLAST search page for me
ACTGCTCTGGTCGTTGTGGTCAGGAGAATCATGTCTGGTGAACGGCAATTAAAGATCTGGTCATAGCTCCGTATACTACTTCATGTTCGGCAGCGGAGTGGGGTAGCCTGCTGGTGTCCATAAAACCCGTTTCGGTGACTATAGGAGACATGGCTGGAGCACACGATCGATATCAAGGACTTCCAAGTGATCTTTACCGCTGCGAGGTCCCAATACGGAGATATTATTGCCATCGACGACGTGAAGCTGAGAATGTGCCAGGAGGTCTACCTTCAGAGGTCTACCTTCATCGAGGAACCAATATCACGGATTCACTGGGCTACCATGGGCTACCAAATGACCGACTGCTC

Full Affymetrix probeset data:

Annotations for 1624817_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720