FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624820_at:

>probe:Drosophila_2:1624820_at:299:9; Interrogation_Position=105; Antisense; ATTCCAGTGGCCACCCATCGAGAAA
>probe:Drosophila_2:1624820_at:688:425; Interrogation_Position=163; Antisense; GAGAGAATCAGTATGTCCACGAATA
>probe:Drosophila_2:1624820_at:179:97; Interrogation_Position=197; Antisense; AGATATTCGGCTTATCGGGCATGAA
>probe:Drosophila_2:1624820_at:273:373; Interrogation_Position=219; Antisense; GAAGTGCCTCAAGGTATTGTCCTTA
>probe:Drosophila_2:1624820_at:398:527; Interrogation_Position=231; Antisense; GGTATTGTCCTTATCACGGAACTAC
>probe:Drosophila_2:1624820_at:701:521; Interrogation_Position=306; Antisense; GTGGCTCAGCTACAACCTAATCGAG
>probe:Drosophila_2:1624820_at:259:479; Interrogation_Position=341; Antisense; GTTTGACTGGTCTGAAATGCCTGAA
>probe:Drosophila_2:1624820_at:225:235; Interrogation_Position=356; Antisense; AATGCCTGAAGGTGCTCTATATAAG
>probe:Drosophila_2:1624820_at:30:407; Interrogation_Position=397; Antisense; GACTGGTCGGAATTCAATCGCCTGG
>probe:Drosophila_2:1624820_at:272:531; Interrogation_Position=450; Antisense; GGTGGTAGGAAATCCCCTATCCGAG
>probe:Drosophila_2:1624820_at:708:303; Interrogation_Position=470; Antisense; CCGAGGGATTGGACGAGCCCACTTG
>probe:Drosophila_2:1624820_at:468:555; Interrogation_Position=537; Antisense; GGACGGAGAACCAGTCGTGCTCAAC
>probe:Drosophila_2:1624820_at:274:337; Interrogation_Position=555; Antisense; GCTCAACGAGGAGCCGCAGCTTTAA
>probe:Drosophila_2:1624820_at:635:717; Interrogation_Position=75; Antisense; TTCCCTGACTGCCAAGGTTATTGAT

Paste this into a BLAST search page for me
ATTCCAGTGGCCACCCATCGAGAAAGAGAGAATCAGTATGTCCACGAATAAGATATTCGGCTTATCGGGCATGAAGAAGTGCCTCAAGGTATTGTCCTTAGGTATTGTCCTTATCACGGAACTACGTGGCTCAGCTACAACCTAATCGAGGTTTGACTGGTCTGAAATGCCTGAAAATGCCTGAAGGTGCTCTATATAAGGACTGGTCGGAATTCAATCGCCTGGGGTGGTAGGAAATCCCCTATCCGAGCCGAGGGATTGGACGAGCCCACTTGGGACGGAGAACCAGTCGTGCTCAACGCTCAACGAGGAGCCGCAGCTTTAATTCCCTGACTGCCAAGGTTATTGAT

Full Affymetrix probeset data:

Annotations for 1624820_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720