FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624821_at:

>probe:Drosophila_2:1624821_at:429:563; Interrogation_Position=1019; Antisense; GGAATCTCCGGAGTTGACCAACCAG
>probe:Drosophila_2:1624821_at:80:95; Interrogation_Position=1030; Antisense; AGTTGACCAACCAGCTGCTATCGGT
>probe:Drosophila_2:1624821_at:249:537; Interrogation_Position=1052; Antisense; GGTCACCTGTTACGCCACTGGTTGG
>probe:Drosophila_2:1624821_at:707:347; Interrogation_Position=1109; Antisense; GCATGTGCTCAAGCGGATCAACCTG
>probe:Drosophila_2:1624821_at:708:33; Interrogation_Position=1125; Antisense; ATCAACCTGCCACTGGTGGAGCGAG
>probe:Drosophila_2:1624821_at:722:377; Interrogation_Position=1163; Antisense; GAAGCTTCGGAACACACGGCTCGAG
>probe:Drosophila_2:1624821_at:87:293; Interrogation_Position=1207; Antisense; CGAGTTTCATCTGCGCCGGCGGAGA
>probe:Drosophila_2:1624821_at:18:575; Interrogation_Position=1224; Antisense; GGCGGAGATCCTGGCAAGGACACCT
>probe:Drosophila_2:1624821_at:166:343; Interrogation_Position=1271; Antisense; GCTTTTCTGCCAAATGCCTGGCGAA
>probe:Drosophila_2:1624821_at:105:637; Interrogation_Position=1336; Antisense; TCGAGTGCGCCGTGGAAGACATTCC
>probe:Drosophila_2:1624821_at:216:9; Interrogation_Position=1356; Antisense; ATTCCGGCGGTGTACGTCAACGTGC
>probe:Drosophila_2:1624821_at:619:39; Interrogation_Position=1384; Antisense; ATCTGCGCGGCTGGATTGACGAGAA
>probe:Drosophila_2:1624821_at:6:275; Interrogation_Position=1419; Antisense; CTTGGAATCGTGCTGCAGGCGCAAT
>probe:Drosophila_2:1624821_at:613:401; Interrogation_Position=945; Antisense; GACATAGCACTATTGCTCCTGGACG

Paste this into a BLAST search page for me
GGAATCTCCGGAGTTGACCAACCAGAGTTGACCAACCAGCTGCTATCGGTGGTCACCTGTTACGCCACTGGTTGGGCATGTGCTCAAGCGGATCAACCTGATCAACCTGCCACTGGTGGAGCGAGGAAGCTTCGGAACACACGGCTCGAGCGAGTTTCATCTGCGCCGGCGGAGAGGCGGAGATCCTGGCAAGGACACCTGCTTTTCTGCCAAATGCCTGGCGAATCGAGTGCGCCGTGGAAGACATTCCATTCCGGCGGTGTACGTCAACGTGCATCTGCGCGGCTGGATTGACGAGAACTTGGAATCGTGCTGCAGGCGCAATGACATAGCACTATTGCTCCTGGACG

Full Affymetrix probeset data:

Annotations for 1624821_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720