FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624822_at:

>probe:Drosophila_2:1624822_at:536:107; Interrogation_Position=5550; Antisense; AGAACTGGCTGATTCTCGTGGCTCA
>probe:Drosophila_2:1624822_at:84:23; Interrogation_Position=5611; Antisense; ATATCGGCCATGTCTTCACAAGAGG
>probe:Drosophila_2:1624822_at:505:245; Interrogation_Position=5676; Antisense; AATTATCGACTCACCTTTGCTGATG
>probe:Drosophila_2:1624822_at:427:439; Interrogation_Position=5697; Antisense; GATGGCCAGCTACCTAAATCATTTG
>probe:Drosophila_2:1624822_at:162:729; Interrogation_Position=5764; Antisense; TTGGGTCCAGATGTCTTCTCTACTC
>probe:Drosophila_2:1624822_at:121:721; Interrogation_Position=5852; Antisense; TTGATCTCTACTCTTGTTGGCGGGA
>probe:Drosophila_2:1624822_at:536:539; Interrogation_Position=5886; Antisense; GGTTCCTCGATACGAAAACGCCACT
>probe:Drosophila_2:1624822_at:701:187; Interrogation_Position=5917; Antisense; AACAGCTCGGCTACATTTATGGGTG
>probe:Drosophila_2:1624822_at:231:65; Interrogation_Position=5935; Antisense; ATGGGTGGACCGAAGTCTCATCCCT
>probe:Drosophila_2:1624822_at:169:555; Interrogation_Position=5961; Antisense; GGACCCCAGTGTGCTCTTGAAAGAG
>probe:Drosophila_2:1624822_at:225:581; Interrogation_Position=6021; Antisense; TGGCGAGTTCATGAGTCTGCAGGCT
>probe:Drosophila_2:1624822_at:401:669; Interrogation_Position=6063; Antisense; TACGTCGGTGGTGGCCAGGCTAAAA
>probe:Drosophila_2:1624822_at:73:495; Interrogation_Position=6089; Antisense; GTCAACTGAATGTCTTCCTTACACC
>probe:Drosophila_2:1624822_at:364:665; Interrogation_Position=6108; Antisense; TACACCGCTTCTACTGGAGGGATTA

Paste this into a BLAST search page for me
AGAACTGGCTGATTCTCGTGGCTCAATATCGGCCATGTCTTCACAAGAGGAATTATCGACTCACCTTTGCTGATGGATGGCCAGCTACCTAAATCATTTGTTGGGTCCAGATGTCTTCTCTACTCTTGATCTCTACTCTTGTTGGCGGGAGGTTCCTCGATACGAAAACGCCACTAACAGCTCGGCTACATTTATGGGTGATGGGTGGACCGAAGTCTCATCCCTGGACCCCAGTGTGCTCTTGAAAGAGTGGCGAGTTCATGAGTCTGCAGGCTTACGTCGGTGGTGGCCAGGCTAAAAGTCAACTGAATGTCTTCCTTACACCTACACCGCTTCTACTGGAGGGATTA

Full Affymetrix probeset data:

Annotations for 1624822_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720