FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624824_at:

>probe:Drosophila_2:1624824_at:401:47; Interrogation_Position=1042; Antisense; ATCCGTGACTCGAACATCTGTGTCT
>probe:Drosophila_2:1624824_at:407:583; Interrogation_Position=1077; Antisense; TGGCGTGTCTACCTGCAACGGTGAC
>probe:Drosophila_2:1624824_at:412:395; Interrogation_Position=1129; Antisense; GACAAGGTCCAGGTCGGTCTTACCT
>probe:Drosophila_2:1624824_at:319:629; Interrogation_Position=1162; Antisense; TCCTCTGCTGGCTGCGAGAAGAACT
>probe:Drosophila_2:1624824_at:364:545; Interrogation_Position=1226; Antisense; GGATCAAGGAGCACACCGGCATCTA
>probe:Drosophila_2:1624824_at:482:87; Interrogation_Position=665; Antisense; AGTCGGGCTGCACCAAGGGATATCC
>probe:Drosophila_2:1624824_at:78:459; Interrogation_Position=683; Antisense; GATATCCATCGGTTTTTACACGCAT
>probe:Drosophila_2:1624824_at:338:269; Interrogation_Position=705; Antisense; CATCACCGCCTATTTGGACTGGATA
>probe:Drosophila_2:1624824_at:170:585; Interrogation_Position=793; Antisense; TGGAACAGCCGTACCCTTAGGAACG
>probe:Drosophila_2:1624824_at:537:703; Interrogation_Position=809; Antisense; TTAGGAACGACATCTCCTTGATCCG
>probe:Drosophila_2:1624824_at:68:345; Interrogation_Position=833; Antisense; GCATTCCTCACGTGGACTACAGCAG
>probe:Drosophila_2:1624824_at:209:113; Interrogation_Position=853; Antisense; AGCAGCGCCATTCATAACGTCGAGC
>probe:Drosophila_2:1624824_at:631:147; Interrogation_Position=896; Antisense; ACTACGCCTCCTATGATGGTGATGA
>probe:Drosophila_2:1624824_at:179:267; Interrogation_Position=982; Antisense; CAGTACGCCCACATGAAGGTCATTT

Paste this into a BLAST search page for me
ATCCGTGACTCGAACATCTGTGTCTTGGCGTGTCTACCTGCAACGGTGACGACAAGGTCCAGGTCGGTCTTACCTTCCTCTGCTGGCTGCGAGAAGAACTGGATCAAGGAGCACACCGGCATCTAAGTCGGGCTGCACCAAGGGATATCCGATATCCATCGGTTTTTACACGCATCATCACCGCCTATTTGGACTGGATATGGAACAGCCGTACCCTTAGGAACGTTAGGAACGACATCTCCTTGATCCGGCATTCCTCACGTGGACTACAGCAGAGCAGCGCCATTCATAACGTCGAGCACTACGCCTCCTATGATGGTGATGACAGTACGCCCACATGAAGGTCATTT

Full Affymetrix probeset data:

Annotations for 1624824_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720