FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624826_at:

>probe:Drosophila_2:1624826_at:134:505; Interrogation_Position=5985; Antisense; GTGCTTCAGGAAGCTCCACTAGAAT
>probe:Drosophila_2:1624826_at:630:687; Interrogation_Position=6021; Antisense; TATATTTTCGCCCTGAGCAGCCATG
>probe:Drosophila_2:1624826_at:385:523; Interrogation_Position=6056; Antisense; GGGCTCCGAAGATACGATCCTTTTC
>probe:Drosophila_2:1624826_at:660:49; Interrogation_Position=6097; Antisense; ATGCCAGCCTGGGAATCAGCACAGA
>probe:Drosophila_2:1624826_at:583:349; Interrogation_Position=6134; Antisense; GCAGTCCTCAATGACCATCGAGCGA
>probe:Drosophila_2:1624826_at:372:411; Interrogation_Position=6157; Antisense; GACCCGTTTCGCATGAGAGCAGTGT
>probe:Drosophila_2:1624826_at:705:101; Interrogation_Position=6172; Antisense; AGAGCAGTGTTAGCCACTCGCTGTT
>probe:Drosophila_2:1624826_at:328:297; Interrogation_Position=6190; Antisense; CGCTGTTGCCGATGTGAGTCCACAA
>probe:Drosophila_2:1624826_at:651:431; Interrogation_Position=6205; Antisense; GAGTCCACAAAACCACACGAGAGCT
>probe:Drosophila_2:1624826_at:310:257; Interrogation_Position=6220; Antisense; CACGAGAGCTCTGTTGGATCCAACG
>probe:Drosophila_2:1624826_at:306:247; Interrogation_Position=6248; Antisense; CCACGTACCGTATACACCATAACTA
>probe:Drosophila_2:1624826_at:112:365; Interrogation_Position=6331; Antisense; GAATTTTCCATATGTGCAACTCCAA
>probe:Drosophila_2:1624826_at:581:3; Interrogation_Position=6456; Antisense; ATTGGCACCCATGAGACCTATTTGT
>probe:Drosophila_2:1624826_at:496:17; Interrogation_Position=6482; Antisense; ATTTTTGTAATATCGCCTGTGTAAC

Paste this into a BLAST search page for me
GTGCTTCAGGAAGCTCCACTAGAATTATATTTTCGCCCTGAGCAGCCATGGGGCTCCGAAGATACGATCCTTTTCATGCCAGCCTGGGAATCAGCACAGAGCAGTCCTCAATGACCATCGAGCGAGACCCGTTTCGCATGAGAGCAGTGTAGAGCAGTGTTAGCCACTCGCTGTTCGCTGTTGCCGATGTGAGTCCACAAGAGTCCACAAAACCACACGAGAGCTCACGAGAGCTCTGTTGGATCCAACGCCACGTACCGTATACACCATAACTAGAATTTTCCATATGTGCAACTCCAAATTGGCACCCATGAGACCTATTTGTATTTTTGTAATATCGCCTGTGTAAC

Full Affymetrix probeset data:

Annotations for 1624826_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720