FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624827_at:

>probe:Drosophila_2:1624827_at:549:69; Interrogation_Position=320; Antisense; AGGCGGCTCTCAACGGGAAGAAGCA
>probe:Drosophila_2:1624827_at:434:109; Interrogation_Position=338; Antisense; AGAAGCAGCTCCTCGATGAATACAC
>probe:Drosophila_2:1624827_at:535:73; Interrogation_Position=395; Antisense; AGGAAATCCAACGAGCCATTGCTGC
>probe:Drosophila_2:1624827_at:546:529; Interrogation_Position=448; Antisense; GGGATCCGTGACAAGCTCTGCACAT
>probe:Drosophila_2:1624827_at:640:117; Interrogation_Position=461; Antisense; AGCTCTGCACATCCGTGAACATTAT
>probe:Drosophila_2:1624827_at:590:227; Interrogation_Position=504; Antisense; AATGGGCGGAAATCTCGATAACATC
>probe:Drosophila_2:1624827_at:303:77; Interrogation_Position=532; Antisense; AGGATGGCCGACAGTGCCCAGAAAG
>probe:Drosophila_2:1624827_at:565:99; Interrogation_Position=555; Antisense; AGAGGCCCTGGAAAAGCGCAGCCTT
>probe:Drosophila_2:1624827_at:458:353; Interrogation_Position=572; Antisense; GCAGCCTTCTGAAAGCGGCCAGGAT
>probe:Drosophila_2:1624827_at:521:531; Interrogation_Position=599; Antisense; GGGTGGAAGAGCTCCATAGCTGCAT
>probe:Drosophila_2:1624827_at:208:27; Interrogation_Position=614; Antisense; ATAGCTGCATGTGCGAGGCTCAGAA
>probe:Drosophila_2:1624827_at:270:659; Interrogation_Position=666; Antisense; TAAGAAGGCCAACGACGCCGCCAAG
>probe:Drosophila_2:1624827_at:439:111; Interrogation_Position=693; Antisense; AGCACAGCAACGGATCGAAGCTTTG
>probe:Drosophila_2:1624827_at:610:391; Interrogation_Position=752; Antisense; GAAAGGATCTTCAGTCGCTCGAGAA

Paste this into a BLAST search page for me
AGGCGGCTCTCAACGGGAAGAAGCAAGAAGCAGCTCCTCGATGAATACACAGGAAATCCAACGAGCCATTGCTGCGGGATCCGTGACAAGCTCTGCACATAGCTCTGCACATCCGTGAACATTATAATGGGCGGAAATCTCGATAACATCAGGATGGCCGACAGTGCCCAGAAAGAGAGGCCCTGGAAAAGCGCAGCCTTGCAGCCTTCTGAAAGCGGCCAGGATGGGTGGAAGAGCTCCATAGCTGCATATAGCTGCATGTGCGAGGCTCAGAATAAGAAGGCCAACGACGCCGCCAAGAGCACAGCAACGGATCGAAGCTTTGGAAAGGATCTTCAGTCGCTCGAGAA

Full Affymetrix probeset data:

Annotations for 1624827_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720