FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624828_at:

>probe:Drosophila_2:1624828_at:28:59; Interrogation_Position=110; Antisense; ATGTACACGTTTGTTGCTCAGCACC
>probe:Drosophila_2:1624828_at:379:425; Interrogation_Position=161; Antisense; GAGAGTGTCATAAATCGGCCATTCA
>probe:Drosophila_2:1624828_at:707:267; Interrogation_Position=20; Antisense; CAGGGCGTATACTTGTTGCTTTGAT
>probe:Drosophila_2:1624828_at:255:465; Interrogation_Position=202; Antisense; GATTGCGATTTCAATGCCAGCTCGG
>probe:Drosophila_2:1624828_at:545:49; Interrogation_Position=215; Antisense; ATGCCAGCTCGGTTCTGCAGGGAAA
>probe:Drosophila_2:1624828_at:155:217; Interrogation_Position=257; Antisense; AAGTTCGACCCATGTTGGAGCGCGC
>probe:Drosophila_2:1624828_at:708:377; Interrogation_Position=292; Antisense; GAACCCACCATCGATGCATATGAGT
>probe:Drosophila_2:1624828_at:472:419; Interrogation_Position=361; Antisense; GAGCTATCTCCGCTGAGTCGTCAAA
>probe:Drosophila_2:1624828_at:607:87; Interrogation_Position=376; Antisense; AGTCGTCAAAGCGACGCCTGTGACA
>probe:Drosophila_2:1624828_at:445:645; Interrogation_Position=410; Antisense; TCTTCTACAGCCTTTGTGCGTATGC
>probe:Drosophila_2:1624828_at:701:711; Interrogation_Position=439; Antisense; TTGATTTTCACCTGTCCGGACAAAA
>probe:Drosophila_2:1624828_at:550:181; Interrogation_Position=511; Antisense; AAAAAATGTCCTTGGCCAGCGCTAA
>probe:Drosophila_2:1624828_at:176:239; Interrogation_Position=57; Antisense; AATAATTCCCTTTCGGGCTGCAAAG
>probe:Drosophila_2:1624828_at:670:567; Interrogation_Position=87; Antisense; GGCAGCGCCCAAATCTGTGCAAAAT

Paste this into a BLAST search page for me
ATGTACACGTTTGTTGCTCAGCACCGAGAGTGTCATAAATCGGCCATTCACAGGGCGTATACTTGTTGCTTTGATGATTGCGATTTCAATGCCAGCTCGGATGCCAGCTCGGTTCTGCAGGGAAAAAGTTCGACCCATGTTGGAGCGCGCGAACCCACCATCGATGCATATGAGTGAGCTATCTCCGCTGAGTCGTCAAAAGTCGTCAAAGCGACGCCTGTGACATCTTCTACAGCCTTTGTGCGTATGCTTGATTTTCACCTGTCCGGACAAAAAAAAAATGTCCTTGGCCAGCGCTAAAATAATTCCCTTTCGGGCTGCAAAGGGCAGCGCCCAAATCTGTGCAAAAT

Full Affymetrix probeset data:

Annotations for 1624828_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720