Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624829_at:

>probe:Drosophila_2:1624829_at:127:535; Interrogation_Position=2766; Antisense; GGTGACCAGCAAGATCTCTACTGAA
>probe:Drosophila_2:1624829_at:351:643; Interrogation_Position=2782; Antisense; TCTACTGAAGTACTGGGCGCCAAGG
>probe:Drosophila_2:1624829_at:342:561; Interrogation_Position=2805; Antisense; GGAAAACATCTCCTCATTGTTTCAG
>probe:Drosophila_2:1624829_at:196:435; Interrogation_Position=2841; Antisense; GAGGGAGGCTGATCCACAGACCACG
>probe:Drosophila_2:1624829_at:596:331; Interrogation_Position=2882; Antisense; GCGGCGAGGATGACTTGTCCTTCAA
>probe:Drosophila_2:1624829_at:408:545; Interrogation_Position=2952; Antisense; GGATGAACGAACAACGGCCTCTGTA
>probe:Drosophila_2:1624829_at:285:715; Interrogation_Position=3025; Antisense; TTCGAGCCAAGCACTACCTTTGAAG
>probe:Drosophila_2:1624829_at:117:693; Interrogation_Position=3043; Antisense; TTTGAAGACCCTCTAGATGCAGTGG
>probe:Drosophila_2:1624829_at:486:349; Interrogation_Position=3090; Antisense; GCAGGATGACATTCGGGCCATGCAA
>probe:Drosophila_2:1624829_at:555:525; Interrogation_Position=3119; Antisense; GGGCAAATTCCCATATTCAAGCTGT
>probe:Drosophila_2:1624829_at:42:607; Interrogation_Position=3188; Antisense; TGATGGACAGGCTCTCGTGCCGTAA
>probe:Drosophila_2:1624829_at:106:303; Interrogation_Position=3248; Antisense; CCGCCGGCTGGAAGTCACAACAAAA
>probe:Drosophila_2:1624829_at:608:355; Interrogation_Position=3317; Antisense; GCACATGGTGATCAGTCGCAGGCTT
>probe:Drosophila_2:1624829_at:686:717; Interrogation_Position=3340; Antisense; TTCGCGGGTCTGCACGATTTTATAA

Paste this into a BLAST search page for me
GGTGACCAGCAAGATCTCTACTGAATCTACTGAAGTACTGGGCGCCAAGGGGAAAACATCTCCTCATTGTTTCAGGAGGGAGGCTGATCCACAGACCACGGCGGCGAGGATGACTTGTCCTTCAAGGATGAACGAACAACGGCCTCTGTATTCGAGCCAAGCACTACCTTTGAAGTTTGAAGACCCTCTAGATGCAGTGGGCAGGATGACATTCGGGCCATGCAAGGGCAAATTCCCATATTCAAGCTGTTGATGGACAGGCTCTCGTGCCGTAACCGCCGGCTGGAAGTCACAACAAAAGCACATGGTGATCAGTCGCAGGCTTTTCGCGGGTCTGCACGATTTTATAA

Full Affymetrix probeset data:

Annotations for 1624829_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime