FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624830_at:

>probe:Drosophila_2:1624830_at:506:429; Interrogation_Position=1137; Antisense; GAGTATGACGAGTCCGGTCCCGGCA
>probe:Drosophila_2:1624830_at:723:85; Interrogation_Position=1174; Antisense; AGTGCTTCTAAGCATCCAAGCCACC
>probe:Drosophila_2:1624830_at:594:175; Interrogation_Position=1200; Antisense; AAACCAGATCAACATCTCCTCGAGC
>probe:Drosophila_2:1624830_at:489:305; Interrogation_Position=1230; Antisense; CCTGGTGTTTGTCTCCAGCGTAAGA
>probe:Drosophila_2:1624830_at:123:627; Interrogation_Position=1243; Antisense; TCCAGCGTAAGACATCCGACCAGGC
>probe:Drosophila_2:1624830_at:195:511; Interrogation_Position=1281; Antisense; GTGAGGACGCAGTTCAGTGAAAAGT
>probe:Drosophila_2:1624830_at:416:51; Interrogation_Position=1378; Antisense; AGACCGGAAACGAGCGGCAACGCCT
>probe:Drosophila_2:1624830_at:501:639; Interrogation_Position=1442; Antisense; TCGGAATTTGTACTGCTTGACTCGC
>probe:Drosophila_2:1624830_at:559:609; Interrogation_Position=1459; Antisense; TGACTCGCTTGCCAGCGCGTAAAGT
>probe:Drosophila_2:1624830_at:508:521; Interrogation_Position=1482; Antisense; GTGGCCAAAACAATCGGTTGTACGT
>probe:Drosophila_2:1624830_at:30:187; Interrogation_Position=942; Antisense; AACAATGTGCTGTCTGGCGGCACTA
>probe:Drosophila_2:1624830_at:13:331; Interrogation_Position=958; Antisense; GCGGCACTACCATGTATCCAGGTAT
>probe:Drosophila_2:1624830_at:485:47; Interrogation_Position=973; Antisense; ATCCAGGTATCGCTGACCGTATGCA
>probe:Drosophila_2:1624830_at:193:255; Interrogation_Position=996; Antisense; CAAAAGGAAATCACCGCACTTGCCC

Paste this into a BLAST search page for me
GAGTATGACGAGTCCGGTCCCGGCAAGTGCTTCTAAGCATCCAAGCCACCAAACCAGATCAACATCTCCTCGAGCCCTGGTGTTTGTCTCCAGCGTAAGATCCAGCGTAAGACATCCGACCAGGCGTGAGGACGCAGTTCAGTGAAAAGTAGACCGGAAACGAGCGGCAACGCCTTCGGAATTTGTACTGCTTGACTCGCTGACTCGCTTGCCAGCGCGTAAAGTGTGGCCAAAACAATCGGTTGTACGTAACAATGTGCTGTCTGGCGGCACTAGCGGCACTACCATGTATCCAGGTATATCCAGGTATCGCTGACCGTATGCACAAAAGGAAATCACCGCACTTGCCC

Full Affymetrix probeset data:

Annotations for 1624830_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720