Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624834_at:

>probe:Drosophila_2:1624834_at:265:417; Interrogation_Position=1549; Antisense; GAGCGCAGCGGAGATAATCCTAGTT
>probe:Drosophila_2:1624834_at:249:675; Interrogation_Position=1587; Antisense; TAGCAACGATTGCAGGCCACTCAAT
>probe:Drosophila_2:1624834_at:684:257; Interrogation_Position=1604; Antisense; CACTCAATTACTTTCCAACTGTTAA
>probe:Drosophila_2:1624834_at:131:109; Interrogation_Position=1628; Antisense; AGAAGTCTTCTGCTGCACACATTTA
>probe:Drosophila_2:1624834_at:118:459; Interrogation_Position=1683; Antisense; GATATTTTTGAAAACGCGCGCCCAA
>probe:Drosophila_2:1624834_at:328:323; Interrogation_Position=1698; Antisense; GCGCGCCCAAATGTCGAGTTTTTTG
>probe:Drosophila_2:1624834_at:156:575; Interrogation_Position=1722; Antisense; GGCGGGAAATGCAACGCACTTCATT
>probe:Drosophila_2:1624834_at:33:253; Interrogation_Position=1733; Antisense; CAACGCACTTCATTCCAATTACATA
>probe:Drosophila_2:1624834_at:239:435; Interrogation_Position=1805; Antisense; GAGGTTTGAGTTGGTTTCGCTGCCA
>probe:Drosophila_2:1624834_at:357:337; Interrogation_Position=1823; Antisense; GCTGCCAAATCACTCGACACAGAAT
>probe:Drosophila_2:1624834_at:101:163; Interrogation_Position=1920; Antisense; AAATAGCTTTCAATTATCGTAGACT
>probe:Drosophila_2:1624834_at:77:647; Interrogation_Position=1967; Antisense; TCATAACTTAATGCCATGCCATATT
>probe:Drosophila_2:1624834_at:655:397; Interrogation_Position=2038; Antisense; GACACTTGTTAAACGATTGGTACTT
>probe:Drosophila_2:1624834_at:266:117; Interrogation_Position=2111; Antisense; AGCTTTAATAGTTTAGTGCCCACAA

Paste this into a BLAST search page for me
GAGCGCAGCGGAGATAATCCTAGTTTAGCAACGATTGCAGGCCACTCAATCACTCAATTACTTTCCAACTGTTAAAGAAGTCTTCTGCTGCACACATTTAGATATTTTTGAAAACGCGCGCCCAAGCGCGCCCAAATGTCGAGTTTTTTGGGCGGGAAATGCAACGCACTTCATTCAACGCACTTCATTCCAATTACATAGAGGTTTGAGTTGGTTTCGCTGCCAGCTGCCAAATCACTCGACACAGAATAAATAGCTTTCAATTATCGTAGACTTCATAACTTAATGCCATGCCATATTGACACTTGTTAAACGATTGGTACTTAGCTTTAATAGTTTAGTGCCCACAA

Full Affymetrix probeset data:

Annotations for 1624834_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime