FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624836_at:

>probe:Drosophila_2:1624836_at:230:645; Interrogation_Position=1714; Antisense; TCATTTGTCTGCTCGCGGGAATTGC
>probe:Drosophila_2:1624836_at:142:527; Interrogation_Position=1730; Antisense; GGGAATTGCTCTGTCCATATCGGAG
>probe:Drosophila_2:1624836_at:46:23; Interrogation_Position=1746; Antisense; ATATCGGAGCACTCTTATTCCACAA
>probe:Drosophila_2:1624836_at:402:159; Interrogation_Position=1767; Antisense; ACAACAGTGGTCTTCGTGATGTCAA
>probe:Drosophila_2:1624836_at:727:605; Interrogation_Position=1783; Antisense; TGATGTCAATTGTCCTCGTGGTTTT
>probe:Drosophila_2:1624836_at:417:273; Interrogation_Position=1811; Antisense; CATTCTGGCCATTCCTGGATATGGA
>probe:Drosophila_2:1624836_at:79:543; Interrogation_Position=1833; Antisense; GGATTTTACTACCTCTACCAGAGCA
>probe:Drosophila_2:1624836_at:460:101; Interrogation_Position=1852; Antisense; AGAGCACGGGCACCTTTTGCGAACG
>probe:Drosophila_2:1624836_at:318:559; Interrogation_Position=1952; Antisense; GGACAACACGGAGATGACCCACCAA
>probe:Drosophila_2:1624836_at:124:125; Interrogation_Position=1972; Antisense; ACCAACTCTTCGAGGTTACTGAGGA
>probe:Drosophila_2:1624836_at:13:539; Interrogation_Position=1997; Antisense; GGTCAACTAGTTACTGATGCACTTA
>probe:Drosophila_2:1624836_at:305:51; Interrogation_Position=2144; Antisense; ATGGGTTTTACAGCGTTTATCTCAC
>probe:Drosophila_2:1624836_at:117:329; Interrogation_Position=2156; Antisense; GCGTTTATCTCACCTGAATCGATCA
>probe:Drosophila_2:1624836_at:467:237; Interrogation_Position=2172; Antisense; AATCGATCAGGTTCACACGTGTGAC

Paste this into a BLAST search page for me
TCATTTGTCTGCTCGCGGGAATTGCGGGAATTGCTCTGTCCATATCGGAGATATCGGAGCACTCTTATTCCACAAACAACAGTGGTCTTCGTGATGTCAATGATGTCAATTGTCCTCGTGGTTTTCATTCTGGCCATTCCTGGATATGGAGGATTTTACTACCTCTACCAGAGCAAGAGCACGGGCACCTTTTGCGAACGGGACAACACGGAGATGACCCACCAAACCAACTCTTCGAGGTTACTGAGGAGGTCAACTAGTTACTGATGCACTTAATGGGTTTTACAGCGTTTATCTCACGCGTTTATCTCACCTGAATCGATCAAATCGATCAGGTTCACACGTGTGAC

Full Affymetrix probeset data:

Annotations for 1624836_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720