FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624837_at:

>probe:Drosophila_2:1624837_at:204:295; Interrogation_Position=273; Antisense; CGATGCACTGCAGCGGATCTACTAT
>probe:Drosophila_2:1624837_at:307:453; Interrogation_Position=288; Antisense; GATCTACTATGGAACTCTTGCGCCA
>probe:Drosophila_2:1624837_at:277:591; Interrogation_Position=323; Antisense; TGGTCAAGTTCTTTTCGCTGAGCAC
>probe:Drosophila_2:1624837_at:250:125; Interrogation_Position=371; Antisense; AGCCCATTCTTCTCGAGCAGGGAAT
>probe:Drosophila_2:1624837_at:513:533; Interrogation_Position=439; Antisense; GGTGGATTCTTCACCTTTGTGACTC
>probe:Drosophila_2:1624837_at:261:419; Interrogation_Position=502; Antisense; GAGCTGCACTACAATCCACTAACGG
>probe:Drosophila_2:1624837_at:353:661; Interrogation_Position=521; Antisense; TAACGGAGGAGTACACGGCCACCAC
>probe:Drosophila_2:1624837_at:245:403; Interrogation_Position=573; Antisense; GACTACTTTCCGACCAAATGATGTG
>probe:Drosophila_2:1624837_at:492:229; Interrogation_Position=589; Antisense; AATGATGTGGTCGTTCCGGAGGTTC
>probe:Drosophila_2:1624837_at:163:471; Interrogation_Position=621; Antisense; GTTCACCTCTTTTCTGGTCAACAAA
>probe:Drosophila_2:1624837_at:354:177; Interrogation_Position=643; Antisense; AAACGACCTCTGTTTGTGGATCCAG
>probe:Drosophila_2:1624837_at:212:519; Interrogation_Position=658; Antisense; GTGGATCCAGCGCTTTTCGATGATC
>probe:Drosophila_2:1624837_at:9:445; Interrogation_Position=676; Antisense; GATGATCCCGAGCACTATGTTAAGA
>probe:Drosophila_2:1624837_at:157:195; Interrogation_Position=731; Antisense; AACTGGATCTGACTCCGAATCCTGA

Paste this into a BLAST search page for me
CGATGCACTGCAGCGGATCTACTATGATCTACTATGGAACTCTTGCGCCATGGTCAAGTTCTTTTCGCTGAGCACAGCCCATTCTTCTCGAGCAGGGAATGGTGGATTCTTCACCTTTGTGACTCGAGCTGCACTACAATCCACTAACGGTAACGGAGGAGTACACGGCCACCACGACTACTTTCCGACCAAATGATGTGAATGATGTGGTCGTTCCGGAGGTTCGTTCACCTCTTTTCTGGTCAACAAAAAACGACCTCTGTTTGTGGATCCAGGTGGATCCAGCGCTTTTCGATGATCGATGATCCCGAGCACTATGTTAAGAAACTGGATCTGACTCCGAATCCTGA

Full Affymetrix probeset data:

Annotations for 1624837_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720