Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624839_at:

>probe:Drosophila_2:1624839_at:635:677; Interrogation_Position=1534; Antisense; TAGTTTCCTGGCTTATATCCTGGAA
>probe:Drosophila_2:1624839_at:444:681; Interrogation_Position=1547; Antisense; TATATCCTGGAAACCCGTCGACGAG
>probe:Drosophila_2:1624839_at:374:571; Interrogation_Position=1571; Antisense; GGCTAAGGACCTTCATCAGACGCAC
>probe:Drosophila_2:1624839_at:379:539; Interrogation_Position=1671; Antisense; GGTATTCTACCAGGACATCGCCAAA
>probe:Drosophila_2:1624839_at:315:177; Interrogation_Position=1693; Antisense; AAACTACCTCAGTCCAAGTACTTGG
>probe:Drosophila_2:1624839_at:130:219; Interrogation_Position=1708; Antisense; AAGTACTTGGTGTTGAATTGCCTCA
>probe:Drosophila_2:1624839_at:339:467; Interrogation_Position=1719; Antisense; GTTGAATTGCCTCATGTATCATGTA
>probe:Drosophila_2:1624839_at:711:111; Interrogation_Position=1760; Antisense; AGCAAATCAGCAAAAGTCTTCCAAA
>probe:Drosophila_2:1624839_at:58:117; Interrogation_Position=1857; Antisense; AGCATAACTCTTACACATAGTCGTA
>probe:Drosophila_2:1624839_at:209:271; Interrogation_Position=1872; Antisense; CATAGTCGTACATCTCCATTTAAGT
>probe:Drosophila_2:1624839_at:331:79; Interrogation_Position=1899; Antisense; AGGTTTTGTACCATAGCCAGCTAAG
>probe:Drosophila_2:1624839_at:256:335; Interrogation_Position=1918; Antisense; GCTAAGCCGCTTAGGGTTTCTCTCG
>probe:Drosophila_2:1624839_at:69:479; Interrogation_Position=1933; Antisense; GTTTCTCTCGCTCTTAAGTCTAATC
>probe:Drosophila_2:1624839_at:496:157; Interrogation_Position=1982; Antisense; ACACAAATCTATTCGTAAGGCCACG

Paste this into a BLAST search page for me
TAGTTTCCTGGCTTATATCCTGGAATATATCCTGGAAACCCGTCGACGAGGGCTAAGGACCTTCATCAGACGCACGGTATTCTACCAGGACATCGCCAAAAAACTACCTCAGTCCAAGTACTTGGAAGTACTTGGTGTTGAATTGCCTCAGTTGAATTGCCTCATGTATCATGTAAGCAAATCAGCAAAAGTCTTCCAAAAGCATAACTCTTACACATAGTCGTACATAGTCGTACATCTCCATTTAAGTAGGTTTTGTACCATAGCCAGCTAAGGCTAAGCCGCTTAGGGTTTCTCTCGGTTTCTCTCGCTCTTAAGTCTAATCACACAAATCTATTCGTAAGGCCACG

Full Affymetrix probeset data:

Annotations for 1624839_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime