FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624840_at:

>probe:Drosophila_2:1624840_at:392:3; Interrogation_Position=192; Antisense; ATTGGTTTACATACAACGCGCTTAA
>probe:Drosophila_2:1624840_at:452:1; Interrogation_Position=267; Antisense; GTAGCTTGCTGGAGTTTAAGGCCCA
>probe:Drosophila_2:1624840_at:207:99; Interrogation_Position=291; Antisense; AGATGGAAATCCAGCTTCAGCCGTT
>probe:Drosophila_2:1624840_at:124:657; Interrogation_Position=324; Antisense; TAATGCGACACCATGCATCCAACAT
>probe:Drosophila_2:1624840_at:639:729; Interrogation_Position=390; Antisense; TTGGCTCCAGACATTTTCACATCGA
>probe:Drosophila_2:1624840_at:494:191; Interrogation_Position=430; Antisense; AACTTGGTTTGAGGCATATGTCACA
>probe:Drosophila_2:1624840_at:76:55; Interrogation_Position=464; Antisense; ATGAACGGTCATCTGGCGAACATCC
>probe:Drosophila_2:1624840_at:393:589; Interrogation_Position=504; Antisense; TGGATGGCATCTTGGCGTTAGCACC
>probe:Drosophila_2:1624840_at:542:475; Interrogation_Position=520; Antisense; GTTAGCACCCAACAATAGCTACTGG
>probe:Drosophila_2:1624840_at:69:389; Interrogation_Position=566; Antisense; GAAAATGGCGGCACATTCGTCTCCA
>probe:Drosophila_2:1624840_at:704:555; Interrogation_Position=599; Antisense; GGACGAGAACCCTTCTTTGTCAAAT
>probe:Drosophila_2:1624840_at:347:365; Interrogation_Position=652; Antisense; GAATCAATGCGTTTACATCTATGCT
>probe:Drosophila_2:1624840_at:229:181; Interrogation_Position=708; Antisense; AAAAATCTTTCGTTTGCCAAGCAGA
>probe:Drosophila_2:1624840_at:667:719; Interrogation_Position=721; Antisense; TTGCCAAGCAGACCAGTGGGCCTAA

Paste this into a BLAST search page for me
ATTGGTTTACATACAACGCGCTTAAGTAGCTTGCTGGAGTTTAAGGCCCAAGATGGAAATCCAGCTTCAGCCGTTTAATGCGACACCATGCATCCAACATTTGGCTCCAGACATTTTCACATCGAAACTTGGTTTGAGGCATATGTCACAATGAACGGTCATCTGGCGAACATCCTGGATGGCATCTTGGCGTTAGCACCGTTAGCACCCAACAATAGCTACTGGGAAAATGGCGGCACATTCGTCTCCAGGACGAGAACCCTTCTTTGTCAAATGAATCAATGCGTTTACATCTATGCTAAAAATCTTTCGTTTGCCAAGCAGATTGCCAAGCAGACCAGTGGGCCTAA

Full Affymetrix probeset data:

Annotations for 1624840_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720