Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624841_s_at:

>probe:Drosophila_2:1624841_s_at:159:431; Interrogation_Position=123; Antisense; GAGTATGCGATGCAACGCCTCATCA
>probe:Drosophila_2:1624841_s_at:442:299; Interrogation_Position=138; Antisense; CGCCTCATCAACTTCATACGACAAA
>probe:Drosophila_2:1624841_s_at:629:431; Interrogation_Position=186; Antisense; GAGTGTTACGATGTCACCGGACGCA
>probe:Drosophila_2:1624841_s_at:37:59; Interrogation_Position=267; Antisense; ATGATCTTCCTGATCGTGGCCATGT
>probe:Drosophila_2:1624841_s_at:92:113; Interrogation_Position=333; Antisense; AGCAACAAGCGAGCTGGCGGCCGAC
>probe:Drosophila_2:1624841_s_at:564:331; Interrogation_Position=349; Antisense; GCGGCCGACGCGACAATAACCAGGA
>probe:Drosophila_2:1624841_s_at:557:695; Interrogation_Position=434; Antisense; TTCTACGAAACCTGAGCATCCACAA
>probe:Drosophila_2:1624841_s_at:423:419; Interrogation_Position=447; Antisense; GAGCATCCACAACACAATTTTCAGA
>probe:Drosophila_2:1624841_s_at:475:649; Interrogation_Position=467; Antisense; TCAGACCGCAATTCCTTGTTTTGTT
>probe:Drosophila_2:1624841_s_at:604:475; Interrogation_Position=484; Antisense; GTTTTGTTAATTCTCCCACTATTGG
>probe:Drosophila_2:1624841_s_at:528:163; Interrogation_Position=531; Antisense; AAATCAATCGACTTGGTGGCATCCA
>probe:Drosophila_2:1624841_s_at:96:49; Interrogation_Position=551; Antisense; ATCCATTCGCACGTTTACACAGAAC
>probe:Drosophila_2:1624841_s_at:260:567; Interrogation_Position=584; Antisense; GGCAAATTATACACCTCTTACATTG
>probe:Drosophila_2:1624841_s_at:635:389; Interrogation_Position=634; Antisense; GAAACACACCGGCTTATCAACTAAC

Paste this into a BLAST search page for me
GAGTATGCGATGCAACGCCTCATCACGCCTCATCAACTTCATACGACAAAGAGTGTTACGATGTCACCGGACGCAATGATCTTCCTGATCGTGGCCATGTAGCAACAAGCGAGCTGGCGGCCGACGCGGCCGACGCGACAATAACCAGGATTCTACGAAACCTGAGCATCCACAAGAGCATCCACAACACAATTTTCAGATCAGACCGCAATTCCTTGTTTTGTTGTTTTGTTAATTCTCCCACTATTGGAAATCAATCGACTTGGTGGCATCCAATCCATTCGCACGTTTACACAGAACGGCAAATTATACACCTCTTACATTGGAAACACACCGGCTTATCAACTAAC

Full Affymetrix probeset data:

Annotations for 1624841_s_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime