Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624845_a_at:

>probe:Drosophila_2:1624845_a_at:179:329; Interrogation_Position=250; Antisense; GCGTCAAACCCAATCGGAATCCTAG
>probe:Drosophila_2:1624845_a_at:548:367; Interrogation_Position=266; Antisense; GAATCCTAGATGCTTTTCAGTGGCC
>probe:Drosophila_2:1624845_a_at:616:713; Interrogation_Position=281; Antisense; TTCAGTGGCCACTCGAGAATGATTC
>probe:Drosophila_2:1624845_a_at:138:359; Interrogation_Position=306; Antisense; GCAACAACTAAGATCCGCCGAAGCT
>probe:Drosophila_2:1624845_a_at:715:449; Interrogation_Position=317; Antisense; GATCCGCCGAAGCTGCAATGTTGTA
>probe:Drosophila_2:1624845_a_at:393:583; Interrogation_Position=415; Antisense; TGGCATTTATTTGGGCGTTCCGTTT
>probe:Drosophila_2:1624845_a_at:701:263; Interrogation_Position=430; Antisense; CGTTCCGTTTAGAGATCGCGACCGA
>probe:Drosophila_2:1624845_a_at:30:131; Interrogation_Position=450; Antisense; ACCGATGAAACGGACTTCTAGCAAA
>probe:Drosophila_2:1624845_a_at:416:537; Interrogation_Position=524; Antisense; GGTCAGGTTCACCAGAAGCCTTTTA
>probe:Drosophila_2:1624845_a_at:431:379; Interrogation_Position=538; Antisense; GAAGCCTTTTAATTGGGATCAGTGA
>probe:Drosophila_2:1624845_a_at:513:3; Interrogation_Position=638; Antisense; ATTGTTACTTATATTTTGCGCTTTA
>probe:Drosophila_2:1624845_a_at:170:459; Interrogation_Position=785; Antisense; GATTTGCTACCACTAAGACCGATTA
>probe:Drosophila_2:1624845_a_at:654:411; Interrogation_Position=801; Antisense; GACCGATTAAATTGCTACCGAAGTG
>probe:Drosophila_2:1624845_a_at:372:247; Interrogation_Position=810; Antisense; AATTGCTACCGAAGTGCTATTTCAA

Paste this into a BLAST search page for me
GCGTCAAACCCAATCGGAATCCTAGGAATCCTAGATGCTTTTCAGTGGCCTTCAGTGGCCACTCGAGAATGATTCGCAACAACTAAGATCCGCCGAAGCTGATCCGCCGAAGCTGCAATGTTGTATGGCATTTATTTGGGCGTTCCGTTTCGTTCCGTTTAGAGATCGCGACCGAACCGATGAAACGGACTTCTAGCAAAGGTCAGGTTCACCAGAAGCCTTTTAGAAGCCTTTTAATTGGGATCAGTGAATTGTTACTTATATTTTGCGCTTTAGATTTGCTACCACTAAGACCGATTAGACCGATTAAATTGCTACCGAAGTGAATTGCTACCGAAGTGCTATTTCAA

Full Affymetrix probeset data:

Annotations for 1624845_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime