FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624846_at:

>probe:Drosophila_2:1624846_at:602:615; Interrogation_Position=1119; Antisense; TGAATCGGTTTCAAAGCACCCAAAT
>probe:Drosophila_2:1624846_at:638:209; Interrogation_Position=1132; Antisense; AAGCACCCAAATTTTACTACGAATG
>probe:Drosophila_2:1624846_at:136:351; Interrogation_Position=1174; Antisense; GCAGTACTCAAACTTGTTCGATCAA
>probe:Drosophila_2:1624846_at:700:133; Interrogation_Position=1218; Antisense; ACCCATCTGCATTTTGACAACGCAA
>probe:Drosophila_2:1624846_at:476:387; Interrogation_Position=1303; Antisense; GAACAATTCGACGTCAGGCTAATGG
>probe:Drosophila_2:1624846_at:545:221; Interrogation_Position=1328; Antisense; AAGGGAGCCAATGCGCGAAACATCT
>probe:Drosophila_2:1624846_at:390:323; Interrogation_Position=1340; Antisense; GCGCGAAACATCTCGGATTTCAAAT
>probe:Drosophila_2:1624846_at:371:65; Interrogation_Position=1384; Antisense; ATGGTAGATCCATCCGACACAAGTA
>probe:Drosophila_2:1624846_at:89:467; Interrogation_Position=1406; Antisense; GTAATCCCCGCCAGAAACGTAGCTA
>probe:Drosophila_2:1624846_at:725:47; Interrogation_Position=1451; Antisense; ATGCCAATGGCCAGATACGCTACAT
>probe:Drosophila_2:1624846_at:670:27; Interrogation_Position=1465; Antisense; ATACGCTACATTTTGGTGGGCATTT
>probe:Drosophila_2:1624846_at:584:515; Interrogation_Position=1480; Antisense; GTGGGCATTTTCAGTTTTTCATCGA
>probe:Drosophila_2:1624846_at:33:57; Interrogation_Position=1531; Antisense; ATGAGGCACACGGATTGGATTCTTT
>probe:Drosophila_2:1624846_at:376:461; Interrogation_Position=1548; Antisense; GATTCTTTCCTTGCTATATTCGTTA

Paste this into a BLAST search page for me
TGAATCGGTTTCAAAGCACCCAAATAAGCACCCAAATTTTACTACGAATGGCAGTACTCAAACTTGTTCGATCAAACCCATCTGCATTTTGACAACGCAAGAACAATTCGACGTCAGGCTAATGGAAGGGAGCCAATGCGCGAAACATCTGCGCGAAACATCTCGGATTTCAAATATGGTAGATCCATCCGACACAAGTAGTAATCCCCGCCAGAAACGTAGCTAATGCCAATGGCCAGATACGCTACATATACGCTACATTTTGGTGGGCATTTGTGGGCATTTTCAGTTTTTCATCGAATGAGGCACACGGATTGGATTCTTTGATTCTTTCCTTGCTATATTCGTTA

Full Affymetrix probeset data:

Annotations for 1624846_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720