FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624847_at:

>probe:Drosophila_2:1624847_at:382:661; Interrogation_Position=107; Antisense; TAACAAATCAACATCGCGACTCCTT
>probe:Drosophila_2:1624847_at:398:63; Interrogation_Position=13; Antisense; ATGGGTGAACGCTACAATATCCACA
>probe:Drosophila_2:1624847_at:556:727; Interrogation_Position=130; Antisense; TTGGCCAGCTACATGGGTCACTACG
>probe:Drosophila_2:1624847_at:5:65; Interrogation_Position=142; Antisense; ATGGGTCACTACGATATTCTCAACT
>probe:Drosophila_2:1624847_at:646:11; Interrogation_Position=157; Antisense; ATTCTCAACTACTTTGCCATAGCGG
>probe:Drosophila_2:1624847_at:47:73; Interrogation_Position=194; Antisense; AGGCACGAGTGCGATTTAATCTGAT
>probe:Drosophila_2:1624847_at:135:697; Interrogation_Position=208; Antisense; TTTAATCTGATGGAGCGAATGCTGC
>probe:Drosophila_2:1624847_at:296:369; Interrogation_Position=224; Antisense; GAATGCTGCAGCCATGTGGGCCACC
>probe:Drosophila_2:1624847_at:449:339; Interrogation_Position=23; Antisense; GCTACAATATCCACAGCCAGCTGGA
>probe:Drosophila_2:1624847_at:538:517; Interrogation_Position=239; Antisense; GTGGGCCACCACCAGAAAAGCTAGA
>probe:Drosophila_2:1624847_at:490:551; Interrogation_Position=45; Antisense; GGAGCATCTACAAAGCAAGTACATC
>probe:Drosophila_2:1624847_at:614:489; Interrogation_Position=63; Antisense; GTACATCGGAACAGGACACGCGGAT
>probe:Drosophila_2:1624847_at:99:157; Interrogation_Position=78; Antisense; ACACGCGGATACCACAAAGTTCGAG
>probe:Drosophila_2:1624847_at:510:255; Interrogation_Position=92; Antisense; CAAAGTTCGAGTGGCTAACAAATCA

Paste this into a BLAST search page for me
TAACAAATCAACATCGCGACTCCTTATGGGTGAACGCTACAATATCCACATTGGCCAGCTACATGGGTCACTACGATGGGTCACTACGATATTCTCAACTATTCTCAACTACTTTGCCATAGCGGAGGCACGAGTGCGATTTAATCTGATTTTAATCTGATGGAGCGAATGCTGCGAATGCTGCAGCCATGTGGGCCACCGCTACAATATCCACAGCCAGCTGGAGTGGGCCACCACCAGAAAAGCTAGAGGAGCATCTACAAAGCAAGTACATCGTACATCGGAACAGGACACGCGGATACACGCGGATACCACAAAGTTCGAGCAAAGTTCGAGTGGCTAACAAATCA

Full Affymetrix probeset data:

Annotations for 1624847_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720