FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624848_at:

>probe:Drosophila_2:1624848_at:547:219; Interrogation_Position=1022; Antisense; AAGTGCCAAGAGTACTTTCCCACCG
>probe:Drosophila_2:1624848_at:507:459; Interrogation_Position=1182; Antisense; GATTACATTTTCACTTCTTTCCCAG
>probe:Drosophila_2:1624848_at:659:111; Interrogation_Position=1210; Antisense; AGCAGAGCGCTGTGACGACTTTTCC
>probe:Drosophila_2:1624848_at:197:609; Interrogation_Position=1222; Antisense; TGACGACTTTTCCACGGCGTTTATT
>probe:Drosophila_2:1624848_at:190:57; Interrogation_Position=704; Antisense; ATGACCCGCGTCATTTACACGCAGA
>probe:Drosophila_2:1624848_at:95:475; Interrogation_Position=740; Antisense; GTTAAGCCGCTGTTTCGCAAGTTAA
>probe:Drosophila_2:1624848_at:115:403; Interrogation_Position=785; Antisense; GACATTCTGGACAGTCTGCGAGACA
>probe:Drosophila_2:1624848_at:45:425; Interrogation_Position=804; Antisense; GAGACATCTGCAAGCACCTGCTCAA
>probe:Drosophila_2:1624848_at:402:155; Interrogation_Position=842; Antisense; ACAGCAAGCGATGCCTACCTAGAAA
>probe:Drosophila_2:1624848_at:491:169; Interrogation_Position=864; Antisense; AAATGGCCATCGGAAACGCGCCTTG
>probe:Drosophila_2:1624848_at:569:315; Interrogation_Position=883; Antisense; GCCTTGGCCCATTGGTGTCACTATG
>probe:Drosophila_2:1624848_at:724:145; Interrogation_Position=902; Antisense; ACTATGGTGGGTATCCACGCTCGTA
>probe:Drosophila_2:1624848_at:455:133; Interrogation_Position=918; Antisense; ACGCTCGTACGGGTCGCGAAAAGAT
>probe:Drosophila_2:1624848_at:666:487; Interrogation_Position=991; Antisense; GTACATCCAGGGTCTCAAACGACTG

Paste this into a BLAST search page for me
AAGTGCCAAGAGTACTTTCCCACCGGATTACATTTTCACTTCTTTCCCAGAGCAGAGCGCTGTGACGACTTTTCCTGACGACTTTTCCACGGCGTTTATTATGACCCGCGTCATTTACACGCAGAGTTAAGCCGCTGTTTCGCAAGTTAAGACATTCTGGACAGTCTGCGAGACAGAGACATCTGCAAGCACCTGCTCAAACAGCAAGCGATGCCTACCTAGAAAAAATGGCCATCGGAAACGCGCCTTGGCCTTGGCCCATTGGTGTCACTATGACTATGGTGGGTATCCACGCTCGTAACGCTCGTACGGGTCGCGAAAAGATGTACATCCAGGGTCTCAAACGACTG

Full Affymetrix probeset data:

Annotations for 1624848_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720