FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624849_at:

>probe:Drosophila_2:1624849_at:81:163; Interrogation_Position=7331; Antisense; AAATTTATGCAAGCTGCCCGCGAGC
>probe:Drosophila_2:1624849_at:202:419; Interrogation_Position=7352; Antisense; GAGCAGCAACTAATCGCTATTTGTA
>probe:Drosophila_2:1624849_at:96:457; Interrogation_Position=7421; Antisense; GATACCCAACATCCTACCATTGAAA
>probe:Drosophila_2:1624849_at:268:125; Interrogation_Position=7460; Antisense; AGCCGCCGGAAATTCTTTCTCAATA
>probe:Drosophila_2:1624849_at:241:5; Interrogation_Position=7471; Antisense; ATTCTTTCTCAATACTGGGCTTTTA
>probe:Drosophila_2:1624849_at:483:567; Interrogation_Position=7488; Antisense; GGCTTTTAGTTTGCTTTCGAGCTGC
>probe:Drosophila_2:1624849_at:3:705; Interrogation_Position=7528; Antisense; TTAGTGTGGACTTCAGTCCGCATCC
>probe:Drosophila_2:1624849_at:408:503; Interrogation_Position=7543; Antisense; GTCCGCATCCGATCTTAGTTCGTAA
>probe:Drosophila_2:1624849_at:651:325; Interrogation_Position=7584; Antisense; GCGACAGGCAACTTCATTTATTCAG
>probe:Drosophila_2:1624849_at:665:483; Interrogation_Position=7608; Antisense; GTATCCATCCATTGATCATTCGTGT
>probe:Drosophila_2:1624849_at:503:717; Interrogation_Position=7626; Antisense; TTCGTGTTCGTGTTTGACTAGTGCA
>probe:Drosophila_2:1624849_at:700:329; Interrogation_Position=7728; Antisense; GCGGAAGTTGCACCGAGTAACAATA
>probe:Drosophila_2:1624849_at:16:403; Interrogation_Position=7765; Antisense; GAGCATTTAGCCGAATTTCCAGTCA
>probe:Drosophila_2:1624849_at:274:573; Interrogation_Position=7882; Antisense; GGCGGCTATTTTATAATCGAGCAAA

Paste this into a BLAST search page for me
AAATTTATGCAAGCTGCCCGCGAGCGAGCAGCAACTAATCGCTATTTGTAGATACCCAACATCCTACCATTGAAAAGCCGCCGGAAATTCTTTCTCAATAATTCTTTCTCAATACTGGGCTTTTAGGCTTTTAGTTTGCTTTCGAGCTGCTTAGTGTGGACTTCAGTCCGCATCCGTCCGCATCCGATCTTAGTTCGTAAGCGACAGGCAACTTCATTTATTCAGGTATCCATCCATTGATCATTCGTGTTTCGTGTTCGTGTTTGACTAGTGCAGCGGAAGTTGCACCGAGTAACAATAGAGCATTTAGCCGAATTTCCAGTCAGGCGGCTATTTTATAATCGAGCAAA

Full Affymetrix probeset data:

Annotations for 1624849_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720