FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624851_at:

>probe:Drosophila_2:1624851_at:100:137; Interrogation_Position=129; Antisense; ACGAAGAGTGCGAGCGCGCTGCATT
>probe:Drosophila_2:1624851_at:254:317; Interrogation_Position=144; Antisense; GCGCTGCATTTGTTTACGATTCCGA
>probe:Drosophila_2:1624851_at:2:633; Interrogation_Position=164; Antisense; TCCGATTCCGATGCCATTGGTCAAT
>probe:Drosophila_2:1624851_at:342:349; Interrogation_Position=265; Antisense; GCAGGGCACACGCAACGTGCAACAT
>probe:Drosophila_2:1624851_at:108:391; Interrogation_Position=385; Antisense; GAAACTCCTTGCCAGAACGAGACAG
>probe:Drosophila_2:1624851_at:157:603; Interrogation_Position=482; Antisense; TGTTTAATGGGAAACCTGCCGCCAA
>probe:Drosophila_2:1624851_at:151:241; Interrogation_Position=536; Antisense; AATAACCGGCGATTGGAGCTACTAC
>probe:Drosophila_2:1624851_at:82:341; Interrogation_Position=553; Antisense; GCTACTACGTGTATATATCGCTGAC
>probe:Drosophila_2:1624851_at:518:683; Interrogation_Position=568; Antisense; TATCGCTGACGTTGGTTCCAGTCTA
>probe:Drosophila_2:1624851_at:659:265; Interrogation_Position=586; Antisense; CAGTCTATTTGGCATTTCGGCTCAT
>probe:Drosophila_2:1624851_at:90:19; Interrogation_Position=599; Antisense; ATTTCGGCTCATTAAGTCGCTGGGC
>probe:Drosophila_2:1624851_at:156:585; Interrogation_Position=624; Antisense; TGGCAGCTCTTCGTCAACAACTGAG
>probe:Drosophila_2:1624851_at:273:585; Interrogation_Position=657; Antisense; TGGACCCGAAACTGTAGCTCAAGCT
>probe:Drosophila_2:1624851_at:429:377; Interrogation_Position=694; Antisense; GAAGCAACATATATCTGTGGCACAA

Paste this into a BLAST search page for me
ACGAAGAGTGCGAGCGCGCTGCATTGCGCTGCATTTGTTTACGATTCCGATCCGATTCCGATGCCATTGGTCAATGCAGGGCACACGCAACGTGCAACATGAAACTCCTTGCCAGAACGAGACAGTGTTTAATGGGAAACCTGCCGCCAAAATAACCGGCGATTGGAGCTACTACGCTACTACGTGTATATATCGCTGACTATCGCTGACGTTGGTTCCAGTCTACAGTCTATTTGGCATTTCGGCTCATATTTCGGCTCATTAAGTCGCTGGGCTGGCAGCTCTTCGTCAACAACTGAGTGGACCCGAAACTGTAGCTCAAGCTGAAGCAACATATATCTGTGGCACAA

Full Affymetrix probeset data:

Annotations for 1624851_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720